FBXL20-F-box and leucine-rich repeat protein 20 Gene View larger

FBXL20-F-box and leucine-rich repeat protein 20 Gene

PTXBC007557

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FBXL20-F-box and leucine-rich repeat protein 20 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FBXL20-F-box and leucine-rich repeat protein 20 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007557
Product type: DNA & cDNA
Ncbi symbol: FBXL20
Origin species: Human
Product name: FBXL20-F-box and leucine-rich repeat protein 20 Gene
Size: 2ug
Accessions: BC007557
Gene id: 84961
Gene description: F-box and leucine-rich repeat protein 20
Synonyms: Fbl2; Fbl20; F-box/LRR-repeat protein 20; F-box protein FBL2; F-box and leucine rich repeat protein 20
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggagggacgtgaacggagtgaccaagagcaggtttgagatgttctcaaatagtgatgaagctgtaatcaataaaaaacttcccaaagaactcctgttacggatattttcttttctagatgttgttaccctgtgccgctgtgctcaggtctccagggcctggaatgttctggctctggatggcagtaactggcagcgaattgacctatttgatttccagagggatattgagggccgagtagtggagaatatttcaaaacgatgtgggggctttttacgaaagttaagtcttcgtggatgtcttggagtgggagacaatgcattaagaacctttgcacaaaactgcaggaacattgaagtactgaatctaaatgggtgtacaaagacaacagacgctacatgtactagccttagcaagttctgttccaaactcaggcaccttgacttggcttcctgtacatcaataacaaacatgtctctaaaagctctgagtgagggatgtccactgttggagcagttgaacatttcctggtgtgaccaagtaaccaaggatggcattcaagcactagtgaggggctgtgggggtctcaaggccttattcttaaaaggctgcacgcagctagaagatgaagctctcaagtacataggtgcacactgccctgaactggtgactttgaacttgcagacttgcttgcaaatcacagatgaaggtctcattactatatgcagagggtgccataagttacaatccctttgtgcctctggctgctccaacatcacagatgccatcctgaatgctctaggtcagaactgcccacggcttagaatattggaagtggcaagatgttctcaattaacagatgtgggctttaccactctagccaggaattgccatgaacttgaaaagatggacctggaagagtgtgttcagataacagatagcacattaatccaactttctatacactgtcctcgacttcaagtattgagtctgtctcactgtgagctgatcacagatgatggaattcgtcacctggggaatggggcctgcgcccatgaccagctggaggtgattgagctggacaactgcccactaatcacagatgcatccctggagcacttgaagagctgtcatagccttgagcggatagaactctatgactgccagcaaatcacacgggctggaatcaagagactcaggacccatttacccaatattaaagtccacgcctacttcgcacctgtcactccacccccatcagtagggggcagcagacagcgcttctgcagatgctgcatcatcctatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ornithine aminotransferase (gyrate atrophy)
- zinc finger and BTB domain containing 26
- TERF1 (TRF1)-interacting nuclear factor 2
- cholinergic receptor, nicotinic, alpha 5

Buy FBXL20-F-box and leucine-rich repeat protein 20 Gene now

Add to cart