ZBTB25-zinc finger and BTB domain containing 25 Gene View larger

ZBTB25-zinc finger and BTB domain containing 25 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZBTB25-zinc finger and BTB domain containing 25 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZBTB25-zinc finger and BTB domain containing 25 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035804
Product type: DNA & cDNA
Ncbi symbol: ZBTB25
Origin species: Human
Product name: ZBTB25-zinc finger and BTB domain containing 25 Gene
Size: 2ug
Accessions: BC035804
Gene id: 7597
Gene description: zinc finger and BTB domain containing 25
Synonyms: C14orf51; ZNF46; zinc finger and BTB domain-containing protein 25; zinc finger protein 46; zinc finger protein KUP; zinc finger and BTB domain containing 25
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacactgccagccatagccttgttcttctccagcagctgaacatgcagcgagaatttggttttctgtgtgattgcacagttgcaattggagatgtttacttcaaagcccacagagcagtgcttgctgctttttctaactatttcaagatgatatttattcaccaaacaagtgaatgcataaaaatacaaccaactgacatccaacctgacatattcagctatttgttgcacattatgtacacggggaaagggccaaaacagattgtggatcatagtcgtttggaggaagggattcgatttcttcacgccgactacctttctcacattgcaactgaaatgaatcaagtgttctcaccagagactgtgcagtcctcaaatttatatggcattcagatctcaacaacccaaaaaacagttgtcaaacaaggactggaggtcaaagaagctccttccagtaacagtggaaacagagctgctgtccagggtgaccacccccagttgcagttgtctcttgctattggtctggatgatggcactgcagaccagcagagggcctgtcctgccacccaggccctggaggagcaccagaagcccccagtttccatcaagcaggagagatgtgacccagaatctgtgatctcccagagccacccctcaccctcatcagaggtgacaggccccacttttactgaaaacagtgtcaaaatacacttatgccattactgtggggaacgttttgattcccgtagtaacctaaggcaacatctccatacacatgtgtctggatccctgccattcggtgtccctgcttccattctggaaagtaatgaccttggtgaagtgcatccccttaatgaaaacagcgaggcccttgaatgccgcaggctcagctccttcattgttaaggagaatgaacagcagccagaccacaccaaccggggtaccacagagcctttgcagatcagtcaagtatctttgatctccaaagacacagagccagtagaattaaactgtaatttttctttttcaaggaaaagaaaaatgagctgtaccatctgtggtcataaattccctcgaaagagccaattgttggaacacatgtatacacacaaaggtaaatcttacagatataaccgatgccaaaggtttggtaatgcattggcccagagatttcagccatactgtgacagctggtctgatgtctccctgaaaagttctcgcttgtcacaagaacacttagacttgccttgtgccttagagtcagagctcacacaagaaaatgtggatactatcctagttgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - F-box and leucine-rich repeat protein 20
- ornithine aminotransferase (gyrate atrophy)
- zinc finger and BTB domain containing 26
- TERF1 (TRF1)-interacting nuclear factor 2

Buy ZBTB25-zinc finger and BTB domain containing 25 Gene now

Add to cart