PHAX-phosphorylated adaptor for RNA export Gene View larger

PHAX-phosphorylated adaptor for RNA export Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PHAX-phosphorylated adaptor for RNA export Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PHAX-phosphorylated adaptor for RNA export Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021161
Product type: DNA & cDNA
Ncbi symbol: PHAX
Origin species: Human
Product name: PHAX-phosphorylated adaptor for RNA export Gene
Size: 2ug
Accessions: BC021161
Gene id: 51808
Gene description: phosphorylated adaptor for RNA export
Synonyms: RNUXA; phosphorylated adapter RNA export protein; RNA U small nuclear RNA export adapter protein; RNA U, small nuclear RNA export adapter (phosphorylation regulated); RNA U, small nuclear RNA export adaptor (phosphorylation regulated); phosphorylated adaptor for RNA export
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgttggaggtcggcgatatggaagatgggcagctttccgactcggattccgacatgacggtcgcacccagcgacaggccgctgcaattgccaaaagtgctaggtggcgacagtgctatgagggccttccagaacacggcaactgcatgtgcaccagtatcacattatcgagctgttgaaagtgtggattcaagtgaagaaagtttttctgattcagatgatgatagctgtctttggaaacgcaaacgacagaaatgttttaaccctcctcccaaaccagagccttttcagtttggccagagcagtcagaaaccacctgttgctggaggaaagaagattaacaacatatggggtgctgtgctgcaggaacagaatcaagatgcagtggccactgaacttggtatcttgggaatggagggcactattgacagaagcagacaatccgagacctacaattatttgcttgccaagaaacttaggaaggaatctcaagagcatacaaaagatctagacaaggaactagatgaatatatgcatggtggcaaaaaaatgggatcaaaggaagaggaaaatgggcaaggtcatctcaaaaggaaacgacctgtcaaagacaggctagggaacagaccagaaatgaactataaaggtcgatacgagatcacagcggaagattctcaagagaaagtggctgatgaaatttcattcaggttacaggaaccaaagaaagacctgatagcccgagtagtgaggattattggtaacaaaaaggcaattgaacttctgatggaaaccgctgaagttgaacaaaatggtggtctctttataatgaatggtagtcgaagaagaacaccaggtggagtttttctgaatctcttgaaaaacactcctagtatcagcgaggaacaaattaaggacattttctacattgaaaaccaaaaggaatatgaaaataaaaaagctgctaggaagaggagaacacaagtgttggggaaaaagatgaaacaagctattaaaagtctaaattttcaagaagatgatgatacatcacgagaaacttttgcaagtgacacgaatgaggccttggcctctcttgatgagtcacaggaaggacatgcagaagccaagttggaggcagaggaagccattgaagttgatcattctcatgatttggacatcttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 2 open reading frame 57
- mitochondrial ribosomal protein S31
- zinc finger, DHHC-type containing 6
- chromosome 4 open reading frame 23

Buy PHAX-phosphorylated adaptor for RNA export Gene now

Add to cart