Login to display prices
Login to display prices
PHAX-phosphorylated adaptor for RNA export Gene View larger

PHAX-phosphorylated adaptor for RNA export Gene

PTXBC021161

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PHAX-phosphorylated adaptor for RNA export Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PHAX-phosphorylated adaptor for RNA export Gene

Proteogenix catalog: PTXBC021161
Ncbi symbol: PHAX
Product name: PHAX-phosphorylated adaptor for RNA export Gene
Size: 2ug
Accessions: BC021161
Gene id: 51808
Gene description: phosphorylated adaptor for RNA export
Synonyms: RNUXA; phosphorylated adapter RNA export protein; RNA U small nuclear RNA export adapter protein; RNA U, small nuclear RNA export adapter (phosphorylation regulated); RNA U, small nuclear RNA export adaptor (phosphorylation regulated); phosphorylated adaptor for RNA export
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgttggaggtcggcgatatggaagatgggcagctttccgactcggattccgacatgacggtcgcacccagcgacaggccgctgcaattgccaaaagtgctaggtggcgacagtgctatgagggccttccagaacacggcaactgcatgtgcaccagtatcacattatcgagctgttgaaagtgtggattcaagtgaagaaagtttttctgattcagatgatgatagctgtctttggaaacgcaaacgacagaaatgttttaaccctcctcccaaaccagagccttttcagtttggccagagcagtcagaaaccacctgttgctggaggaaagaagattaacaacatatggggtgctgtgctgcaggaacagaatcaagatgcagtggccactgaacttggtatcttgggaatggagggcactattgacagaagcagacaatccgagacctacaattatttgcttgccaagaaacttaggaaggaatctcaagagcatacaaaagatctagacaaggaactagatgaatatatgcatggtggcaaaaaaatgggatcaaaggaagaggaaaatgggcaaggtcatctcaaaaggaaacgacctgtcaaagacaggctagggaacagaccagaaatgaactataaaggtcgatacgagatcacagcggaagattctcaagagaaagtggctgatgaaatttcattcaggttacaggaaccaaagaaagacctgatagcccgagtagtgaggattattggtaacaaaaaggcaattgaacttctgatggaaaccgctgaagttgaacaaaatggtggtctctttataatgaatggtagtcgaagaagaacaccaggtggagtttttctgaatctcttgaaaaacactcctagtatcagcgaggaacaaattaaggacattttctacattgaaaaccaaaaggaatatgaaaataaaaaagctgctaggaagaggagaacacaagtgttggggaaaaagatgaaacaagctattaaaagtctaaattttcaagaagatgatgatacatcacgagaaacttttgcaagtgacacgaatgaggccttggcctctcttgatgagtcacaggaaggacatgcagaagccaagttggaggcagaggaagccattgaagttgatcattctcatgatttggacatcttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: