MRPS31-mitochondrial ribosomal protein S31 Gene View larger

MRPS31-mitochondrial ribosomal protein S31 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS31-mitochondrial ribosomal protein S31 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS31-mitochondrial ribosomal protein S31 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022045
Product type: DNA & cDNA
Ncbi symbol: MRPS31
Origin species: Human
Product name: MRPS31-mitochondrial ribosomal protein S31 Gene
Size: 2ug
Accessions: BC022045
Gene id: 10240
Gene description: mitochondrial ribosomal protein S31
Synonyms: IMOGN38; MRP-S31; S31mt; 28S ribosomal protein S31, mitochondrial; imogen 38; mitochondrial ribosomal protein S31
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttcctagagtctcgacgttcctacctcttcgccccctttcccgccaccctttgtcctctggaagcccggagacatcagcggctgcgattatgctactcactgttcggcacggaacagtcaggtaccgcagttcagcgctgttggcccggacaaaaaataacatccaaagatattttggcactaacagtgtgatctgtagcaagaaagataagcagtctgttcgaactgaggagatttccaaggagacttcagagagccaagacagtgaaaaggaaaatacgaaaaaagacttgttaggcattattaagggcatgaaagttgaattaagcacagtaaatgtacgaacaacaaagccccccaaaagaagaccacttaaaagtttggaagctgcacttggcaggcttcgaagagctacagaatatgctccaaagaagagaattgagcccctgagtcctgagttggtggcagctgcatctgctgtggcagattctctcccttttgataagcaaacaaccaagtcagagctgctgagccagctccagcagcatgaggaagagtcaagggcacagagagatgcaaagcgacctaaaattagtttcagtaacataatatcagatatgaaagttgccagatctgctacagctagagttcgttcaagaccagagcttcggattcagtttgatgaaggctatgacaattatcctggccaggagaagacggatgatcttaaaaaaaggaaaaatatattcacagggaaaagacttaatatttttgacatgatggcagttactaaagaagcacctgaaacagacacatcaccttcactttgggatgtggaatttgctaagcagttagccacagtaaatgaacaaccccttcagaatggatttgaagagctgatccagtggacaaaagaggggaaactatgggagttcccaattaacaatgaagcaggttttgatgatgatggttcagaatttcatgaacatatatttctggagaaacacctggagagctttccaaaacaaggaccaattcgccacttcatggagctggtgacttgtggcctttccaaaaacccatatcttagtgttaaacagaaggttgaacacatagagtggtttagaaattattttaatgaaaaaaaggatattctaaaagaaagtaacatacagttcaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, DHHC-type containing 6
- chromosome 4 open reading frame 23
- chromosome 20 open reading frame 3
- vascular endothelial growth factor C

Buy MRPS31-mitochondrial ribosomal protein S31 Gene now

Add to cart