ZDHHC6-zinc finger, DHHC-type containing 6 Gene View larger

ZDHHC6-zinc finger, DHHC-type containing 6 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZDHHC6-zinc finger, DHHC-type containing 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZDHHC6-zinc finger, DHHC-type containing 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007213
Product type: DNA & cDNA
Ncbi symbol: ZDHHC6
Origin species: Human
Product name: ZDHHC6-zinc finger, DHHC-type containing 6 Gene
Size: 2ug
Accessions: BC007213
Gene id: 64429
Gene description: zinc finger, DHHC-type containing 6
Synonyms: palmitoyltransferase ZDHHC6; DHHC-6; ZNF376; transmembrane protein H4; zinc finger DHHC domain-containing protein 6; zinc finger protein 376; zinc finger DHHC-type containing 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtacattctgttcggttatcaagtttgaaaatctacaagaattaaagagactgtgtcactggggtcccatcatagcccttggtgttatagcaatatgttctaccatggccatgattgactctgtgttgtggtattggcccttacatacaactggaggaagtgtgaatttcatcatgttgataaattggactgtcatgattctttataattacttcaatgccatgtttgtcggtccgggctttgtccctctggggtggaaaccggataccatgtatctccagtattgtaaagtctgccaagcatacaaggcaccacgttcacatcactgcagaaagtgtaacagatgtgtgatgaagatggaccatcactgtccttggatcaacaactgttgtggttaccaaaatcatgcttcgttcacactgtttctccttttagcaccactgggttgtatccatgctgctttcatttttgtgatgactatgtacacacagctttatcatcggctctcctttgggtggaacacagtgaagatcgacatgagtgcagcccggagagatcctcttccaattgttccatttggattagctgcatttgctaccaccttgtttgccttgggattagctttaggaacaaccatagctgttgggatgttgttttttatccagatgaaaataattctcagaaacaaaacttctattgagtcatggattgaagagaaggctaaagatcgaattcagtattatcaactagatgaagtctttgtttttccatatgatatgggaagtagatggaggaactttaaacaggtatttacgtggtcaggggtccctgaaggagatggacttgagtggccagtaagagaaggctgtcaccaatacagcttaacaatagaacagttgaaacaaaaagcagataagagagtcagaagtgttcgctataaagtaatagaagattatagtggtgcctgctgccctctgaataaaggaatcaaaaccttcttcacaagtccctgcaccgaagagcctcgaatacagctgcaaaaaggggaattcattttagccacaagaggtttacgatactggttatatggagacaaaattcttgatgattcctttatagaaggtgtttcaagaataaggggttggttccctagaaaatgtgtggaaaagtgtccctgtgatgctgaaacagatcaagccccagagggggagaagaaaaatagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 4 open reading frame 23
- chromosome 20 open reading frame 3
- vascular endothelial growth factor C
- chromosome 7 open reading frame 25

Buy ZDHHC6-zinc finger, DHHC-type containing 6 Gene now

Add to cart