Login to display prices
Login to display prices
C2orf57-chromosome 2 open reading frame 57 Gene View larger

C2orf57-chromosome 2 open reading frame 57 Gene

PTXBC034405

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf57-chromosome 2 open reading frame 57 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf57-chromosome 2 open reading frame 57 Gene

Proteogenix catalog: PTXBC034405
Ncbi symbol: C2orf57
Product name: C2orf57-chromosome 2 open reading frame 57 Gene
Size: 2ug
Accessions: BC034405
Gene id: 165100
Gene description: chromosome 2 open reading frame 57
Synonyms: uncharacterized protein C2orf57; C2orf57; testis expressed 44
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcactcccagggtaccccctgggcaacgtggatgacagcaggtctaaggacagcccagcaggagagccccaaggtcaggtcccactcacagcagatgtcttggcagtgagcagctctgtcgcatccactgactggcaggatatagatcaggcctccttcaagacggccacccccagggccatatcaacatctggagacaaagacaagagtgcagttgttccagaacacggccagaagacacccagaaaaatcacacctctgcttcccagccaaaatccaagtcccctgcaagtgtctatgagccttcagaatccagcgtgggacaggcaggttcaagacgcaaggacaagtcagagtctagtggttttcccaagtcacctcctgggtaaagacaagatgtcacaaatggcgagtgttcctgagagagagccggagtcagccccctctgccccgagtgctgagctacagtccacccagcacatggaggctcagcccgtcgagagtgatgctgaccatgtcacagcaggtgccaatggccagcatggccctcaggctgccagcaccaccaagtctgctgaggagaaagctgagcatccaaaggccccacaccctgaagctgaagctttaccatctgatgagtccccagtggcaatgggggcaaatgtggtggacagcttaggagacctgcagacttggttcttccctccacctccagcaggcagtgtgtccccgtcgcctggcccccacgaggtggccctggggagaaggcccctggaccccagcctgtacacggccagtgaggagaacagctacatgcgctccatgaccagcctgctggacaggggcgagggctccatcagctccctggcagacatcctggtgtggtccgagaccaccatgggcatggccatagccacaggcttcctggattccggccacagcactgtggcagacctgctgcacagctcggggcccagcttgcgctcggtccccagcctggtgggaagcgtcagctcggccttctcctctgggctggtgtcagggaccagctcagccctgcgcaccatcacccgtgtgctggagacagtggagcagaggaccgtggagggcatccgctcagccatgcgctacctgaccagccacctcaccccacgccaggcccaggctgaccccaactatgattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: