FAIM3-Fas apoptotic inhibitory molecule 3 Gene View larger

FAIM3-Fas apoptotic inhibitory molecule 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAIM3-Fas apoptotic inhibitory molecule 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAIM3-Fas apoptotic inhibitory molecule 3 Gene

Proteogenix catalog: PTXBC006401
Ncbi symbol: FAIM3
Product name: FAIM3-Fas apoptotic inhibitory molecule 3 Gene
Size: 2ug
Accessions: BC006401
Gene id: 9214
Gene description: Fas apoptotic inhibitory molecule 3
Synonyms: FAIM3; TOSO; fas apoptotic inhibitory molecule 3; Fc mu receptor; IgM Fc fragment receptor; IgM Fc receptor; immunoglobulin mu Fc receptor; regulator of Fas-induced apoptosis Toso; Fc fragment of IgM receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacttctggctttggccactttacttcctgccagtatcgggggccctgaggatcctcccagaagtaaaggtagagggggagctgggcggatcagttaccatcaagtgcccacttcctgaaatgcatgtgaggatatatctgtgccgggagatggctggatctggaacatgtggtaccgtggtatccaccaccaacttcatcaaggcagaatacaagggccgagttactctgaagcaatacccacgcaagaatctgttcctagtggaggtaacacagctgacagaaagtgacagcggagtctatgcctgcggagcgggcatgaacacagaccggggaaagacccagaaagtcaccctgaatgtccacagtgaatacgagccatcatgggaagagcagccaatgcctgagactccaaaatggtttcatctgccctatttgttccagatgcctgcatatgccagttcttccaaattcgtaaccagagttaccacaccagctcaaaggggcaaggtccctccagttcaccactcctcccccaccacccaaatcacccaccgccctcgagtgtccagagcatcttcagtagcaggtgacaagccccgaaccttcctgccatccactacagcctcaaaaatctcagctctggaggggctgctcaagccccagacgcccagctacaaccaccacaccaggctgcacaggcagagagcactggactatggctcacagtctgggagggaaggccaaggatttcacatcctgatcccgaccatcctgggccttttcctgctggcacttctggggctggtggtgaaaagggccgttgaaaggaggaaagccctctccaggcgggcccgccgactggccgtgaggatgcgcgccctggagagctcccagaggccccgcgggtcgccgcgaccgcgctcccaaaacaacatctacagcgcctgcccgcggcgcgctcgtggagcggacgctgcaggcacaggggaggcccccgttcccggccccggagcgccgttgccccccgccccgctgcaggtgtctgaatctccctggctccatgccccatctctgaagaccagctgtgaatacgtgagcctctaccaccagcctgccgccatgatggaggacagtgattcagatgactacatcaatgttcctgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice