EFCAB4B-EF-hand calcium binding domain 4B Gene View larger

EFCAB4B-EF-hand calcium binding domain 4B Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EFCAB4B-EF-hand calcium binding domain 4B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EFCAB4B-EF-hand calcium binding domain 4B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004524
Product type: DNA & cDNA
Ncbi symbol: EFCAB4B
Origin species: Human
Product name: EFCAB4B-EF-hand calcium binding domain 4B Gene
Size: 2ug
Accessions: BC004524
Gene id: 84766
Gene description: EF-hand calcium binding domain 4B
Synonyms: EFCAB4B; EF-hand calcium-binding domain-containing protein 4B; CRAC channel regulator 2A; CRAC regulator 2A; Ca2+ release-activated Ca2+ (CRAC) channel regulator 2A; EF-hand calcium binding domain 4B; calcium release-activated calcium channel regulator 2A; calcium release activated channel regulator 2A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcccctgacgggagggtagtctccagaccccagagacttggtcaggggtctggccaggggccaaaggggagtggagcctgcctgcatcccctggacagcctggagcagaaggagactcaggagcaaacgtcgggccagctagtcatgctgaggaaggcacaggagttctttcagacctgtgatgctgaaggcaagggcttcatcgccaggaaggatatgcagaggctgcataaggagctaccgctcagcctggaggaactggaggatgtgtttgatgccctggatgctgatggcaatggctatctgaccccacaggagttcactactggatttagtcacttcttcttcagccagaataacccaagtcaggaagatgcaggtgaacaggtggcccagcgccatgaagagaaggtgtatctgtccagaggggatgaggatctgggcgacatgggcgaagatgaggaagcccagttccggatgctgatggacagacttggagcccaaaaggtgttggaagatgaaagtgatgtcaagcagctctggttgcagctgaagaaggaggaacctcatttactgtccaactttgaagacttcctgaccagaatcatctcccagctccaagaagcccatgaggagaagaatgaactggagtgtgccctaaaaaggaaaattgctgcttatgatgaagaaatccagcatctctatgaggagatggaacaacaaatcaaaagtgagaaggagcagtttctcctgaaggacacagagaggtttcaagcccgcagtcaagagctggagcagaaactgttatgtaaggagcaggagctggagcagctcacccagaagcagaaaaggctggaaggtcagtgcacagccctgcatcatgacaagcatgagaccaaggctgagaataccaagctgaaactcactaaccaggagctggcccgggagctggagcggacttcctgggagctccaggatgctcagcagcagttggaaagcctccagcaagaggcctgcaaactccaccaagagaaggagatggaagtgtaccgtgtgacggagagtctacagcgtgagaaggccgggctcctcaagcagctggatttcctaaggtgcgtcggtgggcactggcctgtgctgagagcacctcccagaagcctggggtcggaaggaccagtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 130
- acetyl-Coenzyme A acyltransferase 2
- interferon-induced protein 44-like
- prolactin regulatory element binding

Buy EFCAB4B-EF-hand calcium binding domain 4B Gene now

Add to cart