Login to display prices
Login to display prices
ACAA2-acetyl-Coenzyme A acyltransferase 2 Gene View larger

ACAA2-acetyl-Coenzyme A acyltransferase 2 Gene

PTXBC001918

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACAA2-acetyl-Coenzyme A acyltransferase 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACAA2-acetyl-Coenzyme A acyltransferase 2 Gene

Proteogenix catalog: PTXBC001918
Ncbi symbol: ACAA2
Product name: ACAA2-acetyl-Coenzyme A acyltransferase 2 Gene
Size: 2ug
Accessions: BC001918
Gene id: 10449
Gene description: acetyl-Coenzyme A acyltransferase 2
Synonyms: DSAEC; 3-ketoacyl-CoA thiolase, mitochondrial; acetyl-Coenzyme A acyltransferase 2; beta ketothiolase; mitochondrial 3-oxoacyl-CoA thiolase; mitochondrial 3-oxoacyl-Coenzyme A thiolase; acetyl-CoA acyltransferase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctctgctccgaggtgtgtttgtagttgctgctaagcgaacgccctttggagcttacggaggccttctgaaagacttcactgctactgacttgtctgaatttgctgccaaggctgccttgtctgctggcaaagtctcacctgaaacagttgacagtgtgattatgggcaatgtcctgcagagttcttcagatgctatatatttggcaaggcatgttggtttgcgtgtgggaatcccaaaggagaccccagctctcacgattaataggctctgtggttctggttttcagtccattgtgaatggatgtcaggaaatttgtgttaaagaagctgaagttgttttatgtggaggaaccgaaagcatgagccaagctccctactgtgtcagaaatgtgcgttttggaaccaagcttggatcagatatcaagctggaagattctttatgggtatcattaacagatcagcatgtccagctccccatggcaatgactgcagagaatcttgctgtaaaacacaaaataagcagagaagaatgtgacaaatatgccctgcagtcacagcagagatggaaagctgctaatgatgctggctactttaatgatgaaatggcaccaattgaagtgaagacaaagaaaggaaaacagacaatgcaggtagacgagcatgctcggccccaaaccaccctggaacagttacagaaacttcctccagtattcaagaaagatggaactgttactgcagggaatgcatcgggtgtagctgatggtgctggagctgttatcatagctagtgaagatgctgttaagaaacataacttcacaccactggcaagaattgtgggctactttgtatctggatgtgatccctctatcatgggtattggtcctgtccctgctatcagtggggcactgaagaaagcaggactgagtcttaaggacatggatttggtagaggtgaatgaagcttttgctccccagtacttggctgttgagaggagtttggatcttgacataagtaaaaccaatgtgaatggaggagccattgctttgggtcacccactgggaggatctggatcaagaattactgcacacctggttcacgaattaaggcgtcgaggtggaaaatatgccgttggatcagcttgcattggaggtggccaaggtattgctgtcatcattcagagcacagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: