PA2G4-proliferation-associated 2G4, 38kDa Gene View larger

PA2G4-proliferation-associated 2G4, 38kDa Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PA2G4-proliferation-associated 2G4, 38kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PA2G4-proliferation-associated 2G4, 38kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001951
Product type: DNA & cDNA
Ncbi symbol: PA2G4
Origin species: Human
Product name: PA2G4-proliferation-associated 2G4, 38kDa Gene
Size: 2ug
Accessions: BC001951
Gene id: 5036
Gene description: proliferation-associated 2G4, 38kDa
Synonyms: EBP1; HG4-1; p38-2G4; proliferation-associated protein 2G4; ErbB-3 binding protein 1; ErbB3-binding protein Ebp1; cell cycle protein p38-2G4 homolog; erbB3-binding protein 1; proliferation-associated 2G4, 38kD; proliferation-associated 2G4, 38kDa; proliferation-associated 2G4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgggcgaggacgagcaacaggagcaaactatcgctgaggacctggtcgtgaccaagtataagatggggggcgacatcgccaacagggtacttcggtccttggtggaagcatctagctcaggtgtgtcggtactgagcctgtgtgagaaaggtgatgccatgattatggaagaaacagggaaaatcttcaagaaagaaaaggaaatgaagaaaggtattgcttttcccaccagcatttcggtaaataactgtgtatgtcacttctcccctttgaagagcgaccaggattatattctcaaggaaggtgacttggtaaaaattgaccttggggtccatgtggatggcttcatcgctaatgtagctcacacttttgtggttgatgtagctcaggggacccaagtaacagggaggaaagcagatgttattaaggcagctcacctttgtgctgaagctgccctacgcctggtcaaacctggaaatcagaacacacaagtgacagaagcctggaacaaagttgcccactcatttaactgcacgccaatagaaggtatgctgtcacaccagttgaagcagcatgtcatcgatggagaaaaaaccattatccagaatcccacagaccagcagaagaaggaccatgaaaaagctgaatttgaggtacatgaagtatatgctgtggatgttctcgtcagctcaggagagggcaaggccaaggatgcaggacagagaaccactatttacaaacgagacccctctaaacagtatggactgaaaatgaaaacttcacgtgccttcttcagtgaggtggaaaggcgttttgatgccatgccgtttactttaagagcatttgaagatgagaagaaggctcggatgggtgtggtggagtgcgccaaacatgaactgctgcaaccatttaatgttctctatgagaaggagggtgaatttgttgcccagtttaaatttacagttctgctcatgcccaatggccccatgcggataaccagtggtcccttcgagcctgacctctacaagtctgagatggaggtccaggatgcagagctaaaggccctcctccagagttctgcaagtcgaaaaacccagaaaaagaaaaaaaagaaggcctccaagactgcagagaatgccaccagtggggaaacattagaagaaaatgaagctggggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - EF-hand calcium binding domain 4B
- coiled-coil domain containing 130
- acetyl-Coenzyme A acyltransferase 2
- interferon-induced protein 44-like

Buy PA2G4-proliferation-associated 2G4, 38kDa Gene now

Add to cart