Login to display prices
Login to display prices
BAT4-HLA-B associated transcript 4 Gene View larger

BAT4-HLA-B associated transcript 4 Gene

PTXBC008783

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BAT4-HLA-B associated transcript 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BAT4-HLA-B associated transcript 4 Gene

Proteogenix catalog: PTXBC008783
Ncbi symbol: BAT4
Product name: BAT4-HLA-B associated transcript 4 Gene
Size: 2ug
Accessions: BC008783
Gene id: 7918
Gene description: HLA-B associated transcript 4
Synonyms: protein BAT4; BAT4; ANKRD59; D6S54E; GPATCH10; G patch domain and ankyrin repeat-containing protein 1; G patch domain and ankyrin repeats-containing protein 1; G patch domain containing 10; HLA-B-associated transcript 4; ankyrin repeat domain-containing protein 59; g patch domain-containing protein 10; protein G5; G-patch domain and ankyrin repeats 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccggcccttgctcatcaccttcaccccagccactgaccccagcgacctctggaaggatgggcagcagcagccacagcccgagaagccagagtccaccctggatggggctgcagcccgagctttctatgaggccctgattggggatgagagcagcgctcctgactcccagagatctcagactgaacctgccagagaaagaaagagaaagaaaagaagaataatgaaggcaccagcagcagaagcagtggcagaaggagcatcaggaagacatggacaagggagatcccttgaggctgaggataagatgactcaccggatactgagggcagcccaggagggggacctgccagaacttaggagactgctggaaccgcatgaggcaggaggagctggggggaatatcaacgcccgggatgccttctggtggaccccactgatgtgtgctgctcgagcgggccagggggcagctgtgagctatctcctgggccgtggggctgcctgggtgggggtctgtgagctgagtggcagggatgcggctcagctcgctgaagaagctggcttccctgaggtagcccgcatggtcagggagagccatggagagacaaggagcccggaaaaccggtctcctactccctccctccagtactgcgagaactgtgacacccacttccaagattccaaccaccgcacatccactgctcacctgctgtcactgtcgcagggtcctcagcctcccaaccttccacttggggtgcccatctccagcccgggcttcaaactgctgctgagggggggctgggagccaggaatggggctgggaccccggggtgagggccgtgccaatcccatccccactgtcctcaagagggaccaggaaggactaggctacagatcagcaccccagccccgagtgacacatttcccagcttgggatacccgagctgtggctgggagggagagaccccctcgggtggccacactgagctggagggaggagagaaggagggaggagaaagacagggcttgggagcgggatctaaggacttacatgaacctcgagttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: