BAT4-HLA-B associated transcript 4 Gene View larger

BAT4-HLA-B associated transcript 4 Gene

PTXBC008783

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BAT4-HLA-B associated transcript 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BAT4-HLA-B associated transcript 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008783
Product type: DNA & cDNA
Ncbi symbol: BAT4
Origin species: Human
Product name: BAT4-HLA-B associated transcript 4 Gene
Size: 2ug
Accessions: BC008783
Gene id: 7918
Gene description: HLA-B associated transcript 4
Synonyms: protein BAT4; BAT4; ANKRD59; D6S54E; GPATCH10; G patch domain and ankyrin repeat-containing protein 1; G patch domain and ankyrin repeats-containing protein 1; G patch domain containing 10; HLA-B-associated transcript 4; ankyrin repeat domain-containing protein 59; g patch domain-containing protein 10; protein G5; G-patch domain and ankyrin repeats 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccggcccttgctcatcaccttcaccccagccactgaccccagcgacctctggaaggatgggcagcagcagccacagcccgagaagccagagtccaccctggatggggctgcagcccgagctttctatgaggccctgattggggatgagagcagcgctcctgactcccagagatctcagactgaacctgccagagaaagaaagagaaagaaaagaagaataatgaaggcaccagcagcagaagcagtggcagaaggagcatcaggaagacatggacaagggagatcccttgaggctgaggataagatgactcaccggatactgagggcagcccaggagggggacctgccagaacttaggagactgctggaaccgcatgaggcaggaggagctggggggaatatcaacgcccgggatgccttctggtggaccccactgatgtgtgctgctcgagcgggccagggggcagctgtgagctatctcctgggccgtggggctgcctgggtgggggtctgtgagctgagtggcagggatgcggctcagctcgctgaagaagctggcttccctgaggtagcccgcatggtcagggagagccatggagagacaaggagcccggaaaaccggtctcctactccctccctccagtactgcgagaactgtgacacccacttccaagattccaaccaccgcacatccactgctcacctgctgtcactgtcgcagggtcctcagcctcccaaccttccacttggggtgcccatctccagcccgggcttcaaactgctgctgagggggggctgggagccaggaatggggctgggaccccggggtgagggccgtgccaatcccatccccactgtcctcaagagggaccaggaaggactaggctacagatcagcaccccagccccgagtgacacatttcccagcttgggatacccgagctgtggctgggagggagagaccccctcgggtggccacactgagctggagggaggagagaaggagggaggagaaagacagggcttgggagcgggatctaaggacttacatgaacctcgagttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mab-21-like 1 (C. elegans)
- RNA binding motif protein 4B
- interleukin 8 receptor, beta
- neutrophil cytosolic factor 1

Buy BAT4-HLA-B associated transcript 4 Gene now

Add to cart