NCF1-neutrophil cytosolic factor 1 Gene View larger

NCF1-neutrophil cytosolic factor 1 Gene

PTXBC002816

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NCF1-neutrophil cytosolic factor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NCF1-neutrophil cytosolic factor 1 Gene

Proteogenix catalog: PTXBC002816
Ncbi symbol: NCF1
Product name: NCF1-neutrophil cytosolic factor 1 Gene
Size: 2ug
Accessions: BC002816
Gene id: 653361
Gene description: neutrophil cytosolic factor 1
Synonyms: NCF1A; NOXO2; SH3PXD1A; neutrophil cytosol factor 1; 47 kDa autosomal chronic granulomatous disease protein; 47 kDa neutrophil oxidase factor; NADPH oxidase organizer 2; NCF-1; NCF-47K; SH3 and PX domain-containing protein 1A; neutrophil NADPH oxidase factor 1; neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1); nox organizer 2; nox-organizing protein 2; p47-phox; neutrophil cytosolic factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggacaccttcatccgtcacatcgccctgctgggctttgagaagcgcttcgtacccagccagcactatgtgtacatgttcctggtgaaatggcaggacctgtcggagaaggtggtctaccggcgcttcaccgagatctacgagttccataaaaccttaaaagaaatgttccctattgaggcaggggcgatcaatccagagaacaggatcatcccccacctcccagctcccaagtggtttgacgggcagcgggccgccgagaaccgccagggcacacttaccgagtactgcagcacgctcatgagcctgcccaccaagatctcccgctgtccccacctcctcgacttcttcaaggtgcgccctgatgacctcaagctccccacggacaaccagacaaaaaagccagagacatacttgatgcccaaagatggcaagagtaccgcgacagacatcaccggccccatcatcctgcagacgtaccgcgccattgccaactacgagaagacctcgggctccgagatggctctgtccacgggggacgtggtggaggtcgtagagaagagcgagagcggttggtggttctgtcagatgaaagcaaagcgaggctggatcccagcgtccttcctcgagcccctggacagtcctgacgagacggaagaccctgagcccaactatgcaggtgagccatacgtcgccatcaaggcctacactgctgtggagggggacgaggtgtccctgctcgagggtgaagctgttgaggtcattcacaagctcctggacggctggtgggtcatcaggaaagacgacgtcacaggctacttcccgtccatgtacctgcaaaagtcagggcaagacgtgtcccaggcccaacgccagatcaagcggggggcgccgccccgcaggtcgtccatccgcaacgcgcacagcatccaccagcggtcgcggaagcgcctcagccaggacgcctatcgccgcaacagcgtccgttttctgcagcagcgacgccgccaggcgcggccgggaccgcagagccccgggagcccgctcgaggaggagcggcagacgcagcgctctaaaccgcagccggcggtgcccccgcggccgagcgccgacctcatcctgaaccgctgcagcgagagcaccaagcggaagctggcgtctgccgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice