Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IL8RB-interleukin 8 receptor, beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL8RB-interleukin 8 receptor, beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC037961 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL8RB |
| Origin species: | Human |
| Product name: | IL8RB-interleukin 8 receptor, beta Gene |
| Size: | 2ug |
| Accessions: | BC037961 |
| Gene id: | 3579 |
| Gene description: | interleukin 8 receptor, beta |
| Synonyms: | IL8RB; CD182; CDw128b; CMKAR2; IL8R2; IL8RA; C-X-C chemokine receptor type 2; CXC-R2; CXCR-2; CXCR2 gene for IL8 receptor type B; GRO/MGSA receptor; IL-8 receptor type 2; IL-8R B; chemokine (C-X-C motif) receptor 2; chemokine (CXC) receptor 2; high affinity interleukin-8 receptor B; interleukin 8 receptor B; interleukin 8 receptor type 2; interleukin 8 receptor, beta; interleukin-8 receptor type B; C-X-C motif chemokine receptor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagattttaacatggagagtgacagctttgaagatttctggaaaggtgaagatcttagtaattacagttacagctctaccctgcccccttttctactagatgccgccccatgtgaaccagaatccctggaaatcaacaagtattttgtggtcattatctatgccctggtattcctgctgagcctgctgggaaactccctcgtgatgctggtcatcttatacagcagggtcggccgctccgtcactgatgtctacctgctgaacctagccttggccgacctactctttgccctgaccttgcccatctgggccgcctccaaggtgaatggctggatttttggcacattcctgtgcaaggtggtctcactcctgaaggaagtcaacttctatagtggcatcctgctactggcctgcatcagtgtggaccgttacctggccattgtccatgccacacgcacactgacccagaagcgctacttggtcaaattcatatgtctcagcatctggggtctgtccttgctcctggccctgcctgtcttacttttccgaaggaccgtctactcatccaatgttagcccagcctgctatgaggacatgggcaacaatacagcaaactggcggatgctgttacggatcctgccccagtcctttggcttcatcgtgccactgctgatcatgctgttctgctacggattcaccctgcgtacgctgtttaaggcccacatggggcagaagcaccgggccatgcgggtcatctttgctgtcgtcctcatcttcctgctctgctggctgccctacaacctggtcctgctggcagacaccctcatgaggacccaggtgatccaggagacctgtgagcgccgcaatcacatcgaccgggctctggatgccaccgagattctgggcatccttcacagctgcctcaaccccctcatctacgccttcattggccagaagtttcgccatggactcctcaagattctagctatacatggcttgatcagcaaggactccctgcccaaagacagcaggccttcctttgttggctcttcttcagggcacacttccactactctctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - neutrophil cytosolic factor 1 - RNA binding motif protein 41 - serine/threonine kinase 32B - phospholipid transfer protein |