IL8RB-interleukin 8 receptor, beta Gene View larger

IL8RB-interleukin 8 receptor, beta Gene

PTXBC037961

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL8RB-interleukin 8 receptor, beta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IL8RB-interleukin 8 receptor, beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037961
Product type: DNA & cDNA
Ncbi symbol: IL8RB
Origin species: Human
Product name: IL8RB-interleukin 8 receptor, beta Gene
Size: 2ug
Accessions: BC037961
Gene id: 3579
Gene description: interleukin 8 receptor, beta
Synonyms: IL8RB; CD182; CDw128b; CMKAR2; IL8R2; IL8RA; C-X-C chemokine receptor type 2; CXC-R2; CXCR-2; CXCR2 gene for IL8 receptor type B; GRO/MGSA receptor; IL-8 receptor type 2; IL-8R B; chemokine (C-X-C motif) receptor 2; chemokine (CXC) receptor 2; high affinity interleukin-8 receptor B; interleukin 8 receptor B; interleukin 8 receptor type 2; interleukin 8 receptor, beta; interleukin-8 receptor type B; C-X-C motif chemokine receptor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagattttaacatggagagtgacagctttgaagatttctggaaaggtgaagatcttagtaattacagttacagctctaccctgcccccttttctactagatgccgccccatgtgaaccagaatccctggaaatcaacaagtattttgtggtcattatctatgccctggtattcctgctgagcctgctgggaaactccctcgtgatgctggtcatcttatacagcagggtcggccgctccgtcactgatgtctacctgctgaacctagccttggccgacctactctttgccctgaccttgcccatctgggccgcctccaaggtgaatggctggatttttggcacattcctgtgcaaggtggtctcactcctgaaggaagtcaacttctatagtggcatcctgctactggcctgcatcagtgtggaccgttacctggccattgtccatgccacacgcacactgacccagaagcgctacttggtcaaattcatatgtctcagcatctggggtctgtccttgctcctggccctgcctgtcttacttttccgaaggaccgtctactcatccaatgttagcccagcctgctatgaggacatgggcaacaatacagcaaactggcggatgctgttacggatcctgccccagtcctttggcttcatcgtgccactgctgatcatgctgttctgctacggattcaccctgcgtacgctgtttaaggcccacatggggcagaagcaccgggccatgcgggtcatctttgctgtcgtcctcatcttcctgctctgctggctgccctacaacctggtcctgctggcagacaccctcatgaggacccaggtgatccaggagacctgtgagcgccgcaatcacatcgaccgggctctggatgccaccgagattctgggcatccttcacagctgcctcaaccccctcatctacgccttcattggccagaagtttcgccatggactcctcaagattctagctatacatggcttgatcagcaaggactccctgcccaaagacagcaggccttcctttgttggctcttcttcagggcacacttccactactctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neutrophil cytosolic factor 1
- RNA binding motif protein 41
- serine/threonine kinase 32B
- phospholipid transfer protein

Buy IL8RB-interleukin 8 receptor, beta Gene now

Add to cart