MAB21L1-mab-21-like 1 (C. elegans) Gene View larger

MAB21L1-mab-21-like 1 (C. elegans) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAB21L1-mab-21-like 1 (C. elegans) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAB21L1-mab-21-like 1 (C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028170
Product type: DNA & cDNA
Ncbi symbol: MAB21L1
Origin species: Human
Product name: MAB21L1-mab-21-like 1 (C. elegans) Gene
Size: 2ug
Accessions: BC028170
Gene id: 4081
Gene description: mab-21-like 1 (C. elegans)
Synonyms: CAGR1; Nbla00126; protein mab-21-like 1; mab-21-like protein 1; mab-21 like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattgcggcccaggccaagctggtctaccatctgaataaatactacaacgaaaaatgccaagccaggaaagctgccattgccaaaactatccgggaagtctgcaaagtagtttccgacgtactgaaggaagtggaagtgcaggagccgcggttcatcagctctctcaacgagatggacaatcgctacgagggcctcgaggtcatctcccccaccgaatttgaagtggtgctttatctcaaccaaatgggggtgttcaacttcgtggacgatggctcactgcccggctgcgcggtgctgaagttgagcgacgggcgcaagaggagcatgtccctctgggtggaattcattaccgcctccggctacctctcggcgcgcaaaatccggtccaggtttcagacgctggtggctcaagcggtagacaaatgtagctaccgggatgtggtaaagatggtggcagacaccagcgaagtgaaactgagaatccgagataggtacgtggtgcagatcacgccggcctttaaatgcaccgggatctggccgaggagtgctgcccactggccacttccccacatcccctggccgggacccaaccgggtggcggaggtcaaggcggaaggtttcaatctcttgtccaaggagtgccactccttggccggcaagcagagctcggcggagagcgacgcctgggtgctgcagttcgcggaggcagagaacagactgcagatggggggctgcagaaagaagtgcctctccatcctcaaaaccttaagggatcgtcaccttgaactgccgggccagcccttgaacaattaccatatgaagactctggtttcctacgagtgtgaaaagcatccccgagagtcggactgggacgagtcttgcctgggtgatcggctgaacgggattttgctgcaacttatctcctgcctgcagtgccggcggtgtccccactactttctaccgaacttagatctgtttcaaggcaaacctcactcagctctggaaaacgctgccaaacaaacgtggcgactggcaagagagatcctgaccaacccgaaaagtttggaaaaactttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif protein 4B
- interleukin 8 receptor, beta
- neutrophil cytosolic factor 1
- RNA binding motif protein 41

Buy MAB21L1-mab-21-like 1 (C. elegans) Gene now

Add to cart