KLHDC8B-kelch domain containing 8B Gene View larger

KLHDC8B-kelch domain containing 8B Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KLHDC8B-kelch domain containing 8B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KLHDC8B-kelch domain containing 8B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC039083
Product type: DNA & cDNA
Ncbi symbol: KLHDC8B
Origin species: Human
Product name: KLHDC8B-kelch domain containing 8B Gene
Size: 2ug
Accessions: BC039083
Gene id: 200942
Gene description: kelch domain containing 8B
Synonyms: CHL; kelch domain-containing protein 8B; kelch domain containing 8B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgcaggaggtggccgggcctttgcttggcaagtgttcccccccatgcccacttgccgggtctatggcacagtggcacaccaagatgggcacctgctggtgttggggggttgtggccgggctggactgcccctggacactgctgagacactggacatggcctcgcacacatggctggcactggcacccctgcccactgcccgggctggtgcagctgcggtagttctgggcaagcaggtgctagtggtgggtggtgtggatgaggtccagagcccggtagctgctgtagaggccttcctgatggatgagggccgctgggagcgtcgggccaccctccctcaagcagccatgggggttgcaactgtggagagagatggtatggtgtatgctctggggggaatgggccctgacacggccccccaggcccaggtacgtgtgtatgagccccgtcgggactgctggctttcgctaccctccatgcccacaccctgctatggggcctccaccttcctgcacgggaacaagatctatgtcctggggggccgccagggcaagctcccggtgactgcttttgaagcctttgatctggaggcccgtacatggacccggcatccaagcctacccagccgtcgggcctttgctggctgcgccatggctgaaggcagcgtctttagcctgggtggcctgcagcagcctgggccccacaacttctactctcgcccacactttgtcaacactgtggagatgtttgacctggagcatgggtcctggaccaaattgccccgcagcctgcgcatgagggataagagggcagactttgtggttgggtcccttgggggccacattgtggccattgggggccttggaaaccagccatgtcctttgggctctgtggagagctttagccttgcacggcggcgctgggaggcattgcctgccatgcccactgcccgctgctcctgctctagtctgcaggctgggccccggctgtttgttattgggggtgtggcccagggccccagtcaagccgtggaggcactgtgtctgcgtgatggggtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - HLA-B associated transcript 4
- mab-21-like 1 (C. elegans)
- RNA binding motif protein 4B
- interleukin 8 receptor, beta

Buy KLHDC8B-kelch domain containing 8B Gene now

Add to cart