BCAT2-branched chain aminotransferase 2, mitochondrial Gene View larger

BCAT2-branched chain aminotransferase 2, mitochondrial Gene

PTXBC004243

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BCAT2-branched chain aminotransferase 2, mitochondrial Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BCAT2-branched chain aminotransferase 2, mitochondrial Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004243
Product type: DNA & cDNA
Ncbi symbol: BCAT2
Origin species: Human
Product name: BCAT2-branched chain aminotransferase 2, mitochondrial Gene
Size: 2ug
Accessions: BC004243
Gene id: 587
Gene description: branched chain aminotransferase 2, mitochondrial
Synonyms: BCAM; BCATM; BCT2; PP18; branched-chain-amino-acid aminotransferase, mitochondrial; branched chain amino-acid transaminase 2, mitochondrial; branched chain aminotransferase 2, mitochondrial; placental protein 18; branched chain amino acid transaminase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacacagaagcctcataagaagcctggccccggcgagcccctggtgtttgggaagacatttaccgaccacatgctgatggtggaatggaatgacaagggctggggccagccccgaatccagcccttccagaacctcacgctgcacccagcctcctccagcctccactactccctgcagctgtttgagggcatgaaggcgttcaaaggcaaagaccagcaggtgcgcctcttccgcccctggctcaacatggaccggatgctgcgctcagccatgcgcctgtgcctgccgagtttcgacaagctggagttgctggagtgcatccgccggctcatcgaagtggacaaggactgggtccccgatgccgccggcaccagcctctatgtgcggcctgtgctcattgggaacgagccctcgctgggtgtcagccagcccacgcgcgcgctcctgttcgtcattctctgcccagtgggtgcctacttccctggaggctccgtgaccccggtctccctcctggccgacccagccttcatccgggcctgggtgggcggggtcggcaactacaagttaggtgggaattatgggcccaccgtgttagtgcaacaggaggcactcaagcggggctgtgaacaggtcctctggctgtatgggcccgaccaccagctcaccgaggtgggaaccatgaacatctttgtctactggacccacgaagatggggtgctggagctggtgacgcccccgctgaatggtgttatcctgcctggagtggtcagacagagtctactggacatggctcagacctggggtgagttccgggtggtggagcgcacgatcaccatgaagcagttgctgcgggccctggaggagggccgcgtgcgggaagtctttggctcgggcaccgcttgccaggtctgcccagtgcaccgaatcctgtacaaagacaggaacctccacattcccaccatggaaaatgggcctgagctgatcctccgcttccagaaggagctgaaggagatccagtacggaatcagagcccacgagtggatgttcccggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - progestin and adipoQ receptor family member VIII
- peroxisome proliferator-activated receptor delta
- CDC42 effector protein (Rho GTPase binding) 1
- acyl-Coenzyme A dehydrogenase family, member 11

Buy BCAT2-branched chain aminotransferase 2, mitochondrial Gene now

Add to cart