PPARD-peroxisome proliferator-activated receptor delta Gene View larger

PPARD-peroxisome proliferator-activated receptor delta Gene

PTXBC002715

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPARD-peroxisome proliferator-activated receptor delta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPARD-peroxisome proliferator-activated receptor delta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002715
Product type: DNA & cDNA
Ncbi symbol: PPARD
Origin species: Human
Product name: PPARD-peroxisome proliferator-activated receptor delta Gene
Size: 2ug
Accessions: BC002715
Gene id: 5467
Gene description: peroxisome proliferator-activated receptor delta
Synonyms: FAAR; NR1C2; NUC1; NUCI; NUCII; PPARB; peroxisome proliferator-activated receptor delta; PPAR-beta; PPAR-delta; nuclear hormone receptor 1; nuclear receptor subfamily 1 group C member 2; peroxisome proliferator-activated nuclear receptor beta/delta variant 2; peroxisome proliferator-activated receptor beta; peroxisome proliferator activated receptor delta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcagccacaggaggaagcccctgaggtccgggaagaggaggagaaagaggaagtggcagaggcagaaggagccccagagctcaatgggggaccacagcatgcacttccttccagcagctacacagacctctcccggagctcctcgccaccctcactgctggaccaactgcagatgggctgtgacggggcctcatgcggcagcctcaacatggagtgccgggtgtgcggggacaaggcatcgggcttccactacggtgttcatgcatgtgaggggtgcaagggcttcttccgtcgtacgatccgcatgaagctggagtacgagaagtgtgagcgcagctgcaagattcagaagaagaaccgcaacaagtgccagtactgccgcttccagaagtgcctggcactgggcatgtcacacaacgctatccgttttggtcggatgccggaggctgagaagaggaagctggtggcagggctgactgcaaatgaggggagccagtacaacccacaggtggccgacctgaaggccttctccaagcacatctacaatgcctacctgaaaaacttcaacatgaccaaaaagaaggcccgcagcatcctcaccggcaaagccagccacacggcgccctttgtgatccacgacatcgagacattgtggcaggcagagaaggggctggtgtggaagcagttggtgaatggcctgcctccctacaaggagatcagcgtgcacgtcttctaccgctgccagtgcaccacagtggagaccgtgcgggagctcactgagttcgccaagagcatccccagcttcagcagcctcttcctcaacgaccaggttacccttctcaagtatggcgtgcacgaggccatcttcgccatgctggcctctatcgtcaacaaggacgggctgctggtagccaacggcagtggctttgtcacccgtgagttcctgcgcagcctccgcaaacccttcagtgatatcattgagcctaagtttgaatttgctgtcaagttcaacgccctggaacttgatgacagtgacctggccctattcattgcggccatcattctgtgtggaggtgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CDC42 effector protein (Rho GTPase binding) 1
- acyl-Coenzyme A dehydrogenase family, member 11
- coagulation factor II (thrombin) receptor-like 1
- acyl-CoA synthetase medium-chain family member 3

Buy PPARD-peroxisome proliferator-activated receptor delta Gene now

Add to cart