Login to display prices
Login to display prices
ACAD11-acyl-Coenzyme A dehydrogenase family, member 11 Gene View larger

ACAD11-acyl-Coenzyme A dehydrogenase family, member 11 Gene

PTXBC019607

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACAD11-acyl-Coenzyme A dehydrogenase family, member 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACAD11-acyl-Coenzyme A dehydrogenase family, member 11 Gene

Proteogenix catalog: PTXBC019607
Ncbi symbol: ACAD11
Product name: ACAD11-acyl-Coenzyme A dehydrogenase family, member 11 Gene
Size: 2ug
Accessions: BC019607
Gene id: 84129
Gene description: acyl-Coenzyme A dehydrogenase family, member 11
Synonyms: ACAD-11; acyl-CoA dehydrogenase family member 11; acyl-Coenzyme A dehydrogenase family, member 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaacaacacattcttccagctgaaaaggaggtaactgagttctatgttcaaaatgaaaattcagtggacaagtggggaaaacctttagtgattgataaactcaaggaaatggccaaagtcgagggtctctggaacttgtttttgccagctgtcagcggactcagccacgtggactatgccttgattgctgaagaaacaggaaaatgcttttttgctccagatgtctttaactgccaagcaccagacacagggaatatggaggttctgcacctgtatggaagtgaggaacagaagaaacagtggcttgagcctcttcttcaagggaacattacctcttgcttctgtatgacagaacctgatgtagcttcaagtgatgccacgaatattgaatgcagcatccaacgagatgaagatagctatgtaattaacggcaaaaaatggtggagcagtggagctgggaatcccaagtgcaaaattgcaattgttttgggaagaactcaaaatacttctctctccagacacaaacagcacagcatgattcttgttcccatgaacacacctggagtaaaaataataaggcctttgtcagtttttggctacacagataattttcatggaggacattttgagatccattttaatcaagtgcgagttcctgccacaaatctaatactaggtgaaggtaggggatttgaaatttcccaaggccgccttggacctggcagaatccaccactgtatgagaacagtaggtttggcggaacgcgctttgcagatcatgtgtgagcgggcaacacaaaggatagctttcaagaagaagttgtatgcacatgaggttgtggctcactggattgctgaaagccgcattgccattgagaagatccgcttgttgactctgaaagctgctcacagcatggacactctgggcagtgctggcgctaagaaagagattgcaatgatcaaagtggctgccccacgggctgtcagcaaaatcgttgactgggccatccaggtgtgcggaggtgctggtgtttcccaggattaccctctggctaacatgtatgctataacccgagttttgcgtttagcagatggacctgacgaagttcatctttcagcaatcgcaacaatggagctgcgggaccaagccaaaagactgacagccaagatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: