PAQR8-progestin and adipoQ receptor family member VIII Gene View larger

PAQR8-progestin and adipoQ receptor family member VIII Gene

PTXBC030664

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PAQR8-progestin and adipoQ receptor family member VIII Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PAQR8-progestin and adipoQ receptor family member VIII Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030664
Product type: DNA & cDNA
Ncbi symbol: PAQR8
Origin species: Human
Product name: PAQR8-progestin and adipoQ receptor family member VIII Gene
Size: 2ug
Accessions: BC030664
Gene id: 85315
Gene description: progestin and adipoQ receptor family member VIII
Synonyms: C6orf33; LMPB1; MPRB; membrane progestin receptor beta; lysosomal membrane protein in brain-1; mPR beta; progestin and adipoQ receptor family member VIII; progestin and adipoQ receptor family member 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgaccgccatcttggagcgcctgagcaccctgtcggtcagcgggcagcggctgcgccgcctgcccaagatcctggaggatgggcttcccaagatgccttgcactgtcccagaaacggatgtgccccagctcttccgggagccttacatccgcaccggctaccgccccacggggcacgagtggcgctactacttcttcagcctctttcagaaacacaacgaggtggtcaacgtctggacccatttactggcagccctggccgtcctcttgcgattctgggcctttgccgaggctgaggccttgccatgggcgtctacccactccctgcctctgctcctcttcatcctgtcgtcaatcacttacctcacctgcagccttctggcccacctgctgcagtccaagtcagagctctcccactacaccttctactttgtggactatgttggcgtgagcgtttaccaatatggcagtgctttggctcatttcttctacagctctgaccaggcctggtatgaccggttctggcttttcttcttgccagcagctgccttctgtggctggttatcttgtgctggctgttgctatgccaaatattgttaccggaggccttatccagtcatgaggaagatctgtcaagtggtgccagcaggtctggcttttatcctagacatcagccctgtggcacaccgtgtggcgctctgtcacctggctggctgccaggagcaagcagcctggtaccacaccctccagatcctcttcttcctggttagcgcttatttcttctcctgccccgtgcctgagaagtacttcccgggttcctgtgacatcgtgggccatgggcatcagatcttccatgcatttctgtccatctgtacgctctcccagctggaggccatcctcctggactaccaggggcggcaggagatcttcctgcagcgccatggacccctatctgtccacatggcctgcctctccttcttcttcctggctgcctgcagtgctgccaccgcagcccttctgaggcacaaagtcaaggccagactgaccaagaaagattcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peroxisome proliferator-activated receptor delta
- CDC42 effector protein (Rho GTPase binding) 1
- acyl-Coenzyme A dehydrogenase family, member 11
- coagulation factor II (thrombin) receptor-like 1

Buy PAQR8-progestin and adipoQ receptor family member VIII Gene now

Add to cart