Login to display prices
Login to display prices
PAQR8-progestin and adipoQ receptor family member VIII Gene View larger

PAQR8-progestin and adipoQ receptor family member VIII Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PAQR8-progestin and adipoQ receptor family member VIII Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PAQR8-progestin and adipoQ receptor family member VIII Gene

Proteogenix catalog: PTXBC030664
Ncbi symbol: PAQR8
Product name: PAQR8-progestin and adipoQ receptor family member VIII Gene
Size: 2ug
Accessions: BC030664
Gene id: 85315
Gene description: progestin and adipoQ receptor family member VIII
Synonyms: C6orf33; LMPB1; MPRB; membrane progestin receptor beta; lysosomal membrane protein in brain-1; mPR beta; progestin and adipoQ receptor family member VIII; progestin and adipoQ receptor family member 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgaccgccatcttggagcgcctgagcaccctgtcggtcagcgggcagcggctgcgccgcctgcccaagatcctggaggatgggcttcccaagatgccttgcactgtcccagaaacggatgtgccccagctcttccgggagccttacatccgcaccggctaccgccccacggggcacgagtggcgctactacttcttcagcctctttcagaaacacaacgaggtggtcaacgtctggacccatttactggcagccctggccgtcctcttgcgattctgggcctttgccgaggctgaggccttgccatgggcgtctacccactccctgcctctgctcctcttcatcctgtcgtcaatcacttacctcacctgcagccttctggcccacctgctgcagtccaagtcagagctctcccactacaccttctactttgtggactatgttggcgtgagcgtttaccaatatggcagtgctttggctcatttcttctacagctctgaccaggcctggtatgaccggttctggcttttcttcttgccagcagctgccttctgtggctggttatcttgtgctggctgttgctatgccaaatattgttaccggaggccttatccagtcatgaggaagatctgtcaagtggtgccagcaggtctggcttttatcctagacatcagccctgtggcacaccgtgtggcgctctgtcacctggctggctgccaggagcaagcagcctggtaccacaccctccagatcctcttcttcctggttagcgcttatttcttctcctgccccgtgcctgagaagtacttcccgggttcctgtgacatcgtgggccatgggcatcagatcttccatgcatttctgtccatctgtacgctctcccagctggaggccatcctcctggactaccaggggcggcaggagatcttcctgcagcgccatggacccctatctgtccacatggcctgcctctccttcttcttcctggctgcctgcagtgctgccaccgcagcccttctgaggcacaaagtcaaggccagactgaccaagaaagattcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: