LUC7L-LUC7-like (S. cerevisiae) Gene View larger

LUC7L-LUC7-like (S. cerevisiae) Gene

PTXBC003194

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LUC7L-LUC7-like (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LUC7L-LUC7-like (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003194
Product type: DNA & cDNA
Ncbi symbol: LUC7L
Origin species: Human
Product name: LUC7L-LUC7-like (S. cerevisiae) Gene
Size: 2ug
Accessions: BC003194
Gene id: 55692
Gene description: LUC7-like (S. cerevisiae)
Synonyms: LUC7B1; Luc7; SR+89; hLuc7B1; sarcoplasmic reticulum protein LUC7B1; LUC7 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgcccaggcgcagatgcgggccctgctggaccagctcatgggcacggctcgggacggagacgaaaccagacagagggtcaagtttacagatgaccgtgtctgcaagagtcaccttctggactgctgcccccatgacatcctggctgggacgcgcatggatttaggagaatgtaccaaaatccacgacttggccctccgagcagattatgagattgcaagtaaagaaagagacctgttttttgaattagatgcaatggatcacttggagtcctttattgctgaatgtgatcggagaactgagctcgccaagaagcggctggcagaaacacaggaggaaatcagtgcggaagtttctgcaaaggcagaaaaagtacatgagttaaatgaagaaataggaaaactccttgctaaagccgaacagctaggggctgaaggtaatgtggatgaatcccagaagattcttatggaagtggaaaaagttcgtgcgaagaaaaaagaagctgaggaagaatacagaaattccatgcctgcatccagttttcagcagcaaaagctgcgtgtctgcgaggtctgttcagcctaccttggtctccatgacaatgaccgtcgcctggcagaccacttcggtggcaagttacacttggggttcattcagatccgagagaagcttgatcagttgaggaaaactgtcgctgaaaagcaggagaagagaaatcaggatcgcttgaggaggagagaggagagggaacgggaggagcgtctgagcaggaggtcgggatcaagaaccagagatcgcaggaggtcacgctcccgggatcggcgtcggaggcggtcaagatctacctcccgagagcgacggaaattgtcccggtcccggtcccgagatagacatcggcgccaccgcagccgttcccggagccacagccggggacatcgtcgggcttcccgggaccgaagtgcgaaatacaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein beta subunit-like
- transmembrane protein 19
- transmembrane protein 66
- N-acetylglucosamine kinase

Buy LUC7L-LUC7-like (S. cerevisiae) Gene now

Add to cart