Login to display prices
Login to display prices
TMEM19-transmembrane protein 19 Gene View larger

TMEM19-transmembrane protein 19 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM19-transmembrane protein 19 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM19-transmembrane protein 19 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008596
Product type: DNA & cDNA
Ncbi symbol: TMEM19
Origin species: Human
Product name: TMEM19-transmembrane protein 19 Gene
Size: 2ug
Accessions: BC008596
Gene id: 55266
Gene description: transmembrane protein 19
Synonyms: transmembrane protein 19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagatcttaacgacaatatatgcaaaagatatataaagatgataactaatatagttatactgagcctgatcatttgcatttcgttagctttctggattatatcaatgactgcaagcacctattatggtaacttacgacctatttctccgtggcgttggctgttttctgttgttgttcctgttctgatcgtctctaatggccttaaaaagaaaagtctagatcacagtggggctctaggagggctagtcgttggatttatcctaaccattgcaaatttcagcttttttacctctttgctgatgtttttcttgtcttcttcgaaactcactaaatggaagggagaagtgaagaagcgtctagattcagaatataaggaaggtgggcaaaggaattgggttcaggtgttctgtaatggagctgtacccacagaactggccctgctgtacatgatagaaaatggccccggggaaatcccagtcgatttttccaagcagtactccgcttcctggatgtgtttgtctctcttggctgcactggcctgctctgctggagacacatgggcttcagaagttggcccagttctgagtaaaagttctccaagactgataacaacctgggagaaagttccagttggtaccaatggaggagttacagtggtgggccttgtctccagtctccttggtggtacctttgtgggcattgcatacttcctcacacagctgatttttgtgaatgatttagacatttctgccccgcagtggccaattattgcatttggtggtttagctggattactaggatcaattgtggactcatacttaggggctacaatgcagtatactgggttggatgaaagcactggcatggtggtcaacagcccaacaaataaggcaaggcacatagcagggaaacccattcttgataacaacgcagtgaatctgttttcttctgttcttattgccctcttgctcccaactgctgcttggggtttttggcccagggggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 66
- N-acetylglucosamine kinase
- N-acetylglucosamine kinase
- tubulin folding cofactor C