TMEM66-transmembrane protein 66 Gene View larger

TMEM66-transmembrane protein 66 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM66-transmembrane protein 66 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM66-transmembrane protein 66 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015012
Product type: DNA & cDNA
Ncbi symbol: TMEM66
Origin species: Human
Product name: TMEM66-transmembrane protein 66 Gene
Size: 2ug
Accessions: BC015012
Gene id: 51669
Gene description: transmembrane protein 66
Synonyms: TMEM66; FOAP-7; HSPC035; XTP3; store-operated calcium entry-associated regulatory factor; HBV X-transactivated gene 3 protein; HBV XAg-transactivated protein 3; SARAF long isoform; SARAF short isoform; SOCE-associated regulatory factor; testicular secretory protein Li 59; transmembrane protein 66; store-operated calcium entry associated regulatory factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgcagcctgcgggccgggagcggccgggtactgcttgctcctcggcttgcatttgtttctgctgaccgcgggccctgccctgggctggaacgaccctgacagaatgttgctgcgggatgtaaaagctcttaccctccactatgaccgctataccacctcccgcaggctggatcccatcccacagttgaaatgtgttggaggcacagctggttgtgattcttataccccaaaagtcatacagtgtcagaacaaaggctgggatgggtatgatgtacagtgggaatgtaagacggacttagatattgcatacaaatttggaaaaactgtggtgagctgtgaaggctatgagtcctctgaagaccagtatgtactaagaggttcttgtggcttggagtataatttagattatacagaacttggcctgcagaaactgaaggagtctggaaagcagcacggctttgcctctttctctgattattattataagtggtcctcggcggattcctgtaacatgagtggattgattaccatcgtggtactccttgggatcgcctttgtagtctataagctgttcctgagtgacgggcagtattctcctccaccgtactctgagtatcctccattttcccaccgttaccagagattcaccaactcagcaggacctcctcccccaggctttaagtctgagttcacaggaccacagaatactggccatggtgcaacttctggttttggcagtgcttttacaggacaacaaggatatgaaaattcaggaccagggttctggacaggcttgggaactggtggaatactaggatatttgtttggcagcaatagagcggcaacacccttctcagactcgtggtactacccgtcctatcctccctcctaccctggcacgtggaatagggcttactcaccccttcatggaggctcgggcagctattcggtatgttcaaactcagacacgaaaaccagaactgcatcaggatatggtggtaccaggagacgataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-acetylglucosamine kinase
- N-acetylglucosamine kinase
- tubulin folding cofactor C
- HEAT repeat containing 1

Buy TMEM66-transmembrane protein 66 Gene now

Add to cart