Login to display prices
Login to display prices
GBL-G protein beta subunit-like Gene View larger

GBL-G protein beta subunit-like Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GBL-G protein beta subunit-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GBL-G protein beta subunit-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001313
Product type: DNA & cDNA
Ncbi symbol: GBL
Origin species: Human
Product name: GBL-G protein beta subunit-like Gene
Size: 2ug
Accessions: BC001313
Gene id: 64223
Gene description: G protein beta subunit-like
Synonyms: GBL; GbetaL; LST8; POP3; WAT1; target of rapamycin complex subunit LST8; TORC subunit LST8; gable; mammalian lethal with SEC13 protein 8; protein GbetaL; MTOR associated protein, LST8 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacacctccccaggcacggtgggcagtgacccggtcatcctggccactgcaggctacgaccacaccgtgcgcttctggcaggcccacagcggcatctgcacccggacggtgcagcaccaggactcccaggtgaatgccttggaggtcacaccggaccgcagcatgattgctgctgcaggttaccagcacatccgcatgtatgatctcaactccaataaccctaaccccatcatcagctacgacggcgtcaacaagaacatcgcgtctgtgggcttccacgaagacggccgctggatgtacacgggcggcgaggactgcacagccaggatctgggacctcaggtcccggaacctgcagtgccagcggatcttccaggtgaacgcacccattaactgcgtgtgcctgcaccccaaccaggcagagctcatcgtgggtgaccagagcggggctatccacatctgggacttgaaaacagaccacaacgagcagctgatccctgagcccgaggtctccatcacgtccgcccacatcgatcccgacgccagctacatggcagctgtcaatagcaccggaaactgctatgtctggaatctgacggggggcattggtgacgaggtgacccagctcatccccaagactaagatccctgcccacacgcgctacgccctgcagtgtcgcttcagccccgactccacgctcctcgccacctgctcggctgatcagacgtgcaagatctggaggacgtccaacttctccctgatgacggagctgagcatcaagagcggcaaccccggggagtcctcccgcggctggatgtggggctgcgccttctcgggggactcccagtacatcgtcactgcttcctcggacaacctggcccggctctggtgtgtggagactggagagatcaagagagagtatggcggccaccagaaggctgttgtctgcctggccttcaatgacagtgtgctgggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 19
- transmembrane protein 66
- N-acetylglucosamine kinase
- N-acetylglucosamine kinase