Login to display prices
Login to display prices
HNRNPC-heterogeneous nuclear ribonucleoprotein C (C1/C2) Gene View larger

HNRNPC-heterogeneous nuclear ribonucleoprotein C (C1/C2) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HNRNPC-heterogeneous nuclear ribonucleoprotein C (C1/C2) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HNRNPC-heterogeneous nuclear ribonucleoprotein C (C1/C2) Gene

Proteogenix catalog: PTXBC007052
Ncbi symbol: HNRNPC
Product name: HNRNPC-heterogeneous nuclear ribonucleoprotein C (C1/C2) Gene
Size: 2ug
Accessions: BC007052
Gene id: 3183
Gene description: heterogeneous nuclear ribonucleoprotein C (C1/C2)
Synonyms: HNRNP; HNRPC; SNRPC; heterogeneous nuclear ribonucleoproteins C1/C2; nuclear ribonucleoprotein particle C1 protein; nuclear ribonucleoprotein particle C2 protein; heterogeneous nuclear ribonucleoprotein C (C1/C2)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagcaacgttaccaacaagacagatcctcgctccatgaactcccgtgtattcattgggaatctcaacactcttgtggtcaagaaatctgatgtggaggcaatcttttcgaagtatggcaaaattgtgggctgctctgttcataagggctttgccttcgttcagtatgttaatgagagaaatgcccgggctgctgtagcaggagaggatggcagaatgattgctggccaggttttagatattaacctggctgcagagccaaaagtgaaccgaggaaaagcaggtgtgaaacgatctgcagcggagatgtacgggtcagtaacagaacacccttctccgtcccctctactcagctcctcttttgacttggactatgactttcaacgggactattatgataggatgtacagttacccagcacgtgtacctcctcctcctcctattgctcgggctgtagtgccctcgaaacgtcagcgtgtatcaggaaacacttcacgaaggggcaaaagtggcttcaattctaagagtggacagcggggatcttccaagtctggaaagttgaaaggagatgaccttcaggccattaagaaggagctgacccagataaaacaaaaagtggattctctcctggaaaacctggaaaaaattgaaaaggaacagagcaaacaagcagtagagatgaagaatgataagtcagaagaggagcagagcagcagctccgtgaagaaagatgagactaatgtgaagatggagtctggggggggtgcagatgactctgctgaggagggggacctactggatgatgatgataatgaagatcggggggatgaccagctggagttgatcaaggatgatgaaaaagaggctgaggaaggagaggatgacagagacagcgccaatggcgaggatgactcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: