Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene
PTXBC034694
New product
Data sheet of SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034694 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SULT2B1 |
| Origin species: | Human |
| Product name: | SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC034694 |
| Gene id: | 6820 |
| Gene description: | sulfotransferase family, cytosolic, 2B, member 1 |
| Synonyms: | HSST2; sulfotransferase family cytosolic 2B member 1; ST2B1; alcohol sulfotransferase; hydroxysteroid sulfotransferase 2; sulfotransferase 2B1; sulfotransferase family, cytosolic, 2B, member 1; sulfotransferase family 2B member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgggcccgccgagccccagatcccgggcttgtgggacacctatgaagatgacatctcggaaatcagccagaagttgccaggtgaatacttccggtacaagggcgtccccttccccgtcggcctgtactcgctcgagagcatcagcttggcggagaacacccaagatgtgcgggacgacgacatctttatcatcacctaccccaagtcaggcacgacctggatgatcgagatcatctgcttaatcctgaaggaaggggatccatcctggatccgctccgtgcccatctgggagcgggcaccctggtgtgagaccattgtgggtgccttcagcctcccggaccagtacagcccccgcctcatgagctcccatcttcccatccagatcttcaccaaggccttcttcagctccaaggccaaggtgatctacatgggccgcaacccccgggacgttgtggtctccctctatcattactccaagatcgccgggcagttaaaggacccgggcacacccgaccagttcctgagggacttcctcaaaggcgaagtgcagtttggctcctggttcgaccacattaagggctggcttcggatgaagggcaaagacaacttcctatttatcacctacgaggagctgcagcaggacttacagggctccgtggagcgcatctgtgggttcctgggccgtccgctgggcaaggaggcactgggctccgtcgtggcacactcaaccttcagcgccatgaaggccaacaccatgtccaactacacgctgctgcctcccagcctgctggaccaccgtcgcggggccttcctccggaaaggggtctgtggcgactggaagaaccacttcacggtggcccagagcgaagccttcgatcgtgcctaccgcaagcagatgcgggggatgccgaccttcccctgggatgaagacccggaggaggacggcagcccagatcctgagcccagccctgagcctgagcccaagcccagccttgagcccaacaccagcctggagcgtgagcccagacccaactccagccccagccccagccccggccaggcctctgagaccccgcacccacgaccctcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - v-fos FBJ murine osteosarcoma viral oncogene homolog - mitochondrial translational release factor 1-like - origin recognition complex, subunit 4-like (yeast) - leucine rich repeat containing 8 family, member E |