SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene View larger

SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034694
Product type: DNA & cDNA
Ncbi symbol: SULT2B1
Origin species: Human
Product name: SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene
Size: 2ug
Accessions: BC034694
Gene id: 6820
Gene description: sulfotransferase family, cytosolic, 2B, member 1
Synonyms: HSST2; sulfotransferase family cytosolic 2B member 1; ST2B1; alcohol sulfotransferase; hydroxysteroid sulfotransferase 2; sulfotransferase 2B1; sulfotransferase family, cytosolic, 2B, member 1; sulfotransferase family 2B member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgggcccgccgagccccagatcccgggcttgtgggacacctatgaagatgacatctcggaaatcagccagaagttgccaggtgaatacttccggtacaagggcgtccccttccccgtcggcctgtactcgctcgagagcatcagcttggcggagaacacccaagatgtgcgggacgacgacatctttatcatcacctaccccaagtcaggcacgacctggatgatcgagatcatctgcttaatcctgaaggaaggggatccatcctggatccgctccgtgcccatctgggagcgggcaccctggtgtgagaccattgtgggtgccttcagcctcccggaccagtacagcccccgcctcatgagctcccatcttcccatccagatcttcaccaaggccttcttcagctccaaggccaaggtgatctacatgggccgcaacccccgggacgttgtggtctccctctatcattactccaagatcgccgggcagttaaaggacccgggcacacccgaccagttcctgagggacttcctcaaaggcgaagtgcagtttggctcctggttcgaccacattaagggctggcttcggatgaagggcaaagacaacttcctatttatcacctacgaggagctgcagcaggacttacagggctccgtggagcgcatctgtgggttcctgggccgtccgctgggcaaggaggcactgggctccgtcgtggcacactcaaccttcagcgccatgaaggccaacaccatgtccaactacacgctgctgcctcccagcctgctggaccaccgtcgcggggccttcctccggaaaggggtctgtggcgactggaagaaccacttcacggtggcccagagcgaagccttcgatcgtgcctaccgcaagcagatgcgggggatgccgaccttcccctgggatgaagacccggaggaggacggcagcccagatcctgagcccagccctgagcctgagcccaagcccagccttgagcccaacaccagcctggagcgtgagcccagacccaactccagccccagccccagccccggccaggcctctgagaccccgcacccacgaccctcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - v-fos FBJ murine osteosarcoma viral oncogene homolog
- mitochondrial translational release factor 1-like
- origin recognition complex, subunit 4-like (yeast)
- leucine rich repeat containing 8 family, member E

Buy SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene now

Add to cart