Login to display prices
Login to display prices
SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene View larger

SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene

PTXBC034694

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene

Proteogenix catalog: PTXBC034694
Ncbi symbol: SULT2B1
Product name: SULT2B1-sulfotransferase family, cytosolic, 2B, member 1 Gene
Size: 2ug
Accessions: BC034694
Gene id: 6820
Gene description: sulfotransferase family, cytosolic, 2B, member 1
Synonyms: HSST2; sulfotransferase family cytosolic 2B member 1; ST2B1; alcohol sulfotransferase; hydroxysteroid sulfotransferase 2; sulfotransferase 2B1; sulfotransferase family, cytosolic, 2B, member 1; sulfotransferase family 2B member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgggcccgccgagccccagatcccgggcttgtgggacacctatgaagatgacatctcggaaatcagccagaagttgccaggtgaatacttccggtacaagggcgtccccttccccgtcggcctgtactcgctcgagagcatcagcttggcggagaacacccaagatgtgcgggacgacgacatctttatcatcacctaccccaagtcaggcacgacctggatgatcgagatcatctgcttaatcctgaaggaaggggatccatcctggatccgctccgtgcccatctgggagcgggcaccctggtgtgagaccattgtgggtgccttcagcctcccggaccagtacagcccccgcctcatgagctcccatcttcccatccagatcttcaccaaggccttcttcagctccaaggccaaggtgatctacatgggccgcaacccccgggacgttgtggtctccctctatcattactccaagatcgccgggcagttaaaggacccgggcacacccgaccagttcctgagggacttcctcaaaggcgaagtgcagtttggctcctggttcgaccacattaagggctggcttcggatgaagggcaaagacaacttcctatttatcacctacgaggagctgcagcaggacttacagggctccgtggagcgcatctgtgggttcctgggccgtccgctgggcaaggaggcactgggctccgtcgtggcacactcaaccttcagcgccatgaaggccaacaccatgtccaactacacgctgctgcctcccagcctgctggaccaccgtcgcggggccttcctccggaaaggggtctgtggcgactggaagaaccacttcacggtggcccagagcgaagccttcgatcgtgcctaccgcaagcagatgcgggggatgccgaccttcccctgggatgaagacccggaggaggacggcagcccagatcctgagcccagccctgagcctgagcccaagcccagccttgagcccaacaccagcctggagcgtgagcccagacccaactccagccccagccccagccccggccaggcctctgagaccccgcacccacgaccctcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: