Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FOS-v-fos FBJ murine osteosarcoma viral oncogene homolog Gene
PTXBC004490
New product
Data sheet of FOS-v-fos FBJ murine osteosarcoma viral oncogene homolog Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FOS-v-fos FBJ murine osteosarcoma viral oncogene homolog Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004490 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FOS |
| Origin species: | Human |
| Product name: | FOS-v-fos FBJ murine osteosarcoma viral oncogene homolog Gene |
| Size: | 2ug |
| Accessions: | BC004490 |
| Gene id: | 2353 |
| Gene description: | v-fos FBJ murine osteosarcoma viral oncogene homolog |
| Synonyms: | Fos proto-oncogene, AP-1 transcription factor subunit; cellular oncogene c-fos; Fos proto-oncogene, AP-1 trancription factor subunit; FBJ murine osteosarcoma viral (v-fos) oncogene homolog (oncogene FOS); proto-oncogene c-Fos; AP-1; p55; FBJ murine osteosarcoma viral oncogene homolog; G0/G1 switch regulatory protein 7; activator protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgttctcgggcttcaacgcagactacgaggcgtcatcctcccgctgcagcagcgcgtccccggccggggatagcctctcttactaccactcacccgcagactccttctccagcatgggctcgcctgtcaacgcgcaggacttctgcacggacctggccgtctccagtgccaacttcattcccacggtcactgccatctcgaccagtccggacctgcagtggctggtgcagcccgccctcgtctcctctgtggccccatcgcagaccagagcccctcaccctttcggagtccccgccccctccgctggggcttactccagggctggcgttgtgaagaccatgacaggaggccgagcgcagagcattggcaggaggggcaaggtggaacagttatctccagaagaagaagagaaaaggagaatccgaagggaaaggaataagatggctgcagccaaatgccgcaaccggaggagggagctgactgatacactccaagcggagacagaccaactagaagatgagaagtctgctttgcagaccgagattgccaacctgctgaaggagaaggaaaaactagagttcatcctggcagctcaccgacctgcctgcaagatccctgatgacctgggcttcccagaagagatgtctgtggcttcccttgatctgactgggggcctgccagaggttgccaccccggagtctgaggaggccttcaccctgcctctcctcaatgaccctgagcccaagccctcagtggaacctgtcaagagcatcagcagcatggagctgaagaccgagccctttgatgacttcctgttcccagcatcatccaggcccagtggctctgagacagcccgctccgtgccagacatggacctatctgggtccttctatgcagcagactgggagcctctgcacagtggctccctggggatggggcccatggccacagagctggagcccctgtgcactccggtggtcacctgtactcccagctgcactgcttacacgtcttccttcgtcttcacctaccccgaggctgactccttccccagctgtgcagctgcccaccgcaagggcagcagcagcaatgagccttcctctgactcgctcagctcacccacgctgctggccctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial translational release factor 1-like - origin recognition complex, subunit 4-like (yeast) - leucine rich repeat containing 8 family, member E - immunoglobulin heavy constant gamma 1 (G1m marker) |