WNT2-wingless-type MMTV integration site family member 2 Gene View larger

WNT2-wingless-type MMTV integration site family member 2 Gene

PTXBC029854

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WNT2-wingless-type MMTV integration site family member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WNT2-wingless-type MMTV integration site family member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029854
Product type: DNA & cDNA
Ncbi symbol: WNT2
Origin species: Human
Product name: WNT2-wingless-type MMTV integration site family member 2 Gene
Size: 2ug
Accessions: BC029854
Gene id: 7472
Gene description: wingless-type MMTV integration site family member 2
Synonyms: INT1L1; IRP; protein Wnt-2; Int-1-related protein; int-1-like protein 1; secreted growth factor; wingless-type MMTV integration site family member 2; Wnt family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacgcccctctcggtggaatctggctctggctccctctgctcttgacctggctcacccccgaggtcaactcttcatggtggtacatgagagctacaggtggctcctccagggtgatgtgcgataatgtgccaggcctggtgagcagccagcggcagctgtgtcaccgacatccagatgtgatgcgtgccattagccagggcgtggccgagtggacagcagaatgccagcaccagttccgccagcaccgctggaattgcaacaccctggacagggatcacagcctttttggcagggtcctactccgaagtagtcgggaatctgcctttgtttatgccatctcctcagctggagttgtatttgccatcaccagggcctgtagccaaggagaagtaaaatcctgttcctgtgatccaaagaagatgggaagcgccaaggacagcaaaggcatttttgattggggtggctgcagtgataacattgactatgggatcaaatttgcccgcgcatttgtggatgcaaaggaaaggaaaggaaaggatgccagagccctgatgaatcttcacaacaacagagctggcaggaaggctgtaaagcggttcttgaaacaagagtgcaagtgccacggggtgagcggctcatgtactctcaggacatgctggctggccatggccgacttcaggaaaacgggcgattatctctggaggaagtacaatggggccatccaggtggtcatgaaccaggatggcacaggtttcactgtggctaacgagaggtttaagaagccaacgaaaaatgacctcgtgtattttgagaattctccagactactgtatcagggaccgagaggcaggctccctgggtacagcaggccgtgtgtgcaacctgacttcccggggcatggacagctgtgaagtcatgtgctgtgggagaggctacgacacctcccatgtcacccggatgaccaagtgtgggtgtaagttccactggtgctgcgccgtgcgctgtcaggactgcctggaagctctggatgtgcacacatgcaaggcccccaagaacgctgactggacaaccgctacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sulfotransferase family, cytosolic, 2B, member 1
- v-fos FBJ murine osteosarcoma viral oncogene homolog
- mitochondrial translational release factor 1-like
- origin recognition complex, subunit 4-like (yeast)

Buy WNT2-wingless-type MMTV integration site family member 2 Gene now

Add to cart