Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of APP-amyloid beta (A4) precursor protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about APP-amyloid beta (A4) precursor protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004369 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | APP |
| Origin species: | Human |
| Product name: | APP-amyloid beta (A4) precursor protein Gene |
| Size: | 2ug |
| Accessions: | BC004369 |
| Gene id: | 351 |
| Gene description: | amyloid beta (A4) precursor protein |
| Synonyms: | AAA; ABETA; ABPP; AD1; APPI; CTFgamma; CVAP; PN-II; PN2; amyloid beta A4 protein; alzheimer disease amyloid protein; amyloid beta (A4) precursor protein; amyloid precursor protein; beta-amyloid peptide; beta-amyloid peptide(1-40); beta-amyloid peptide(1-42); beta-amyloid precursor protein; cerebral vascular amyloid peptide; peptidase nexin-II; preA4; protease nexin-II; testicular tissue protein Li 2; amyloid beta precursor protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcccggtttggcactgctcctgctggccgcctggacggctcgggcgctggaggtacccactgatggtaatgctggcctgctggctgaaccccagattgccatgttctgtggcagactgaacatgcacatgaatgtccagaatgggaagtgggattcagatccatcagggaccaaaacctgcattgataccaaggaaggcatcctgcagtattgccaagaagtctaccctgaactgcagatcaccaatgtggtagaagccaaccaaccagtgaccatccagaactggtgcaagcggggccgcaagcagtgcaagacccatccccactttgtgattccctaccgctgcttagttggtgagtttgtaagtgatgcccttctcgttcctgacaagtgcaaattcttacaccaggagaggatggatgtttgcgaaactcatcttcactggcacaccgtcgccaaagagacatgcagtgagaagagtaccaacttgcatgactacggcatgttgctgccctgcggaattgacaagttccgaggggtagagtttgtgtgttgcccactggctgaagaaagtgacaatgtggattctgctgatgcggaggaggatgactcggatgtctggtggggcggagcagacacagactatgcagatgggagtgaagacaaagtagtagaagtagcagaggaggaagaagtggctgaggtggaagaagaagaagccgatgatgacgaggacgatgaggatggtgatgaggtagaggaagaggctgaggaaccctacgaagaagccacagagagaaccaccagcattgccaccaccaccaccaccaccacagagtctgtggaagaggtggttcgagagaagtggtataaggaagtacattctggccaggcacgatggctcatgctgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RIB43A domain with coiled-coils 2 - coiled-coil domain containing 92 - 3-ketodihydrosphingosine reductase - mitochondrial fission regulator 1 |