APP-amyloid beta (A4) precursor protein Gene View larger

APP-amyloid beta (A4) precursor protein Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APP-amyloid beta (A4) precursor protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about APP-amyloid beta (A4) precursor protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004369
Product type: DNA & cDNA
Ncbi symbol: APP
Origin species: Human
Product name: APP-amyloid beta (A4) precursor protein Gene
Size: 2ug
Accessions: BC004369
Gene id: 351
Gene description: amyloid beta (A4) precursor protein
Synonyms: AAA; ABETA; ABPP; AD1; APPI; CTFgamma; CVAP; PN-II; PN2; amyloid beta A4 protein; alzheimer disease amyloid protein; amyloid beta (A4) precursor protein; amyloid precursor protein; beta-amyloid peptide; beta-amyloid peptide(1-40); beta-amyloid peptide(1-42); beta-amyloid precursor protein; cerebral vascular amyloid peptide; peptidase nexin-II; preA4; protease nexin-II; testicular tissue protein Li 2; amyloid beta precursor protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgcccggtttggcactgctcctgctggccgcctggacggctcgggcgctggaggtacccactgatggtaatgctggcctgctggctgaaccccagattgccatgttctgtggcagactgaacatgcacatgaatgtccagaatgggaagtgggattcagatccatcagggaccaaaacctgcattgataccaaggaaggcatcctgcagtattgccaagaagtctaccctgaactgcagatcaccaatgtggtagaagccaaccaaccagtgaccatccagaactggtgcaagcggggccgcaagcagtgcaagacccatccccactttgtgattccctaccgctgcttagttggtgagtttgtaagtgatgcccttctcgttcctgacaagtgcaaattcttacaccaggagaggatggatgtttgcgaaactcatcttcactggcacaccgtcgccaaagagacatgcagtgagaagagtaccaacttgcatgactacggcatgttgctgccctgcggaattgacaagttccgaggggtagagtttgtgtgttgcccactggctgaagaaagtgacaatgtggattctgctgatgcggaggaggatgactcggatgtctggtggggcggagcagacacagactatgcagatgggagtgaagacaaagtagtagaagtagcagaggaggaagaagtggctgaggtggaagaagaagaagccgatgatgacgaggacgatgaggatggtgatgaggtagaggaagaggctgaggaaccctacgaagaagccacagagagaaccaccagcattgccaccaccaccaccaccaccacagagtctgtggaagaggtggttcgagagaagtggtataaggaagtacattctggccaggcacgatggctcatgctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RIB43A domain with coiled-coils 2
- coiled-coil domain containing 92
- 3-ketodihydrosphingosine reductase
- mitochondrial fission regulator 1

Buy APP-amyloid beta (A4) precursor protein Gene now

Add to cart