CCDC92-coiled-coil domain containing 92 Gene View larger

CCDC92-coiled-coil domain containing 92 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC92-coiled-coil domain containing 92 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC92-coiled-coil domain containing 92 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017186
Product type: DNA & cDNA
Ncbi symbol: CCDC92
Origin species: Human
Product name: CCDC92-coiled-coil domain containing 92 Gene
Size: 2ug
Accessions: BC017186
Gene id: 80212
Gene description: coiled-coil domain containing 92
Synonyms: coiled-coil domain-containing protein 92; limkain beta 2; coiled-coil domain containing 92
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacttcaccacatttctcgagttacgatgaaggtcctctggatgtcagcatggcagccacaaacctggagaaccagctgcacagcgcacagaagaacctcctgttccttcagcgggagcatgccagcacgctcaaggggctgcactccgagatcaggcggctgcagcagcactgcacagatttaacatatgagctgacagtcaaaagttcggaacagacaggagacgggacttctaaaagcagtgaattaaagaaaagatgtgaagagctggaagcccaactgaaagtgaaagagaacgaaaatgctgagttgttgaaagaactggagcagaaaaacgcgatgatcacagtgctggagaacaccatcaaggagcgagagaagaagtacctggaggagctgaaggccaagagtcacaagctgaccctgctgtctagcgagctggagcagcgggccagcaccatcgcctacctgacctcccagctgcacgccgccaagaagaagctcatgagctccagcgggacctcagatgccagcccgtcagggagccccgtgctggccagctacaagccagcgccccccaaagacaagctacccgaaacgcctcgccgccgcatgaaaaagagcctctcagcccccttgcacccggaatttgaagaggtctacagattcggggcagagagcaggaaactccttttgcgggaaccagtggatgctatgcccgaccccaccccatttctgctggctagggagtccgccgaggtccacctcatcaaagagaggcccctcgtcatcccccccatcgcctccgaccgaagcggcgagcagcacagcccggcccgcgaaaagccgcacaaggcccacgtcggggtggcacatcggatccaccacgccaccccgccgcaggcccagcccgaggtgaagaccctggcggtcgaccaggtgaacggaggcaaggtggtgaggaagcactcagggacggacagaactgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 3-ketodihydrosphingosine reductase
- mitochondrial fission regulator 1
- O-sialoglycoprotein endopeptidase
- coiled-coil domain containing 33

Buy CCDC92-coiled-coil domain containing 92 Gene now

Add to cart