MTFR1-mitochondrial fission regulator 1 Gene View larger

MTFR1-mitochondrial fission regulator 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTFR1-mitochondrial fission regulator 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MTFR1-mitochondrial fission regulator 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036116
Product type: DNA & cDNA
Ncbi symbol: MTFR1
Origin species: Human
Product name: MTFR1-mitochondrial fission regulator 1 Gene
Size: 2ug
Accessions: BC036116
Gene id: 9650
Gene description: mitochondrial fission regulator 1
Synonyms: FAM54A2; mitochondrial fission regulator 1; chondrocyte protein with a poly-proline region
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttggctggattaagcgcctaattaggatggtttttcaacaagttggagtaagcatgcaatcggtactttggtctaggaagccatatggttcgtctcgaagtatcgtaaggaaaattggtactaatttgtctctgattcagtgtccaagagttcagtttcagattaacagccatgcaacagaatggagtcccagccacccaggagaggatgcagtggcgtcttttgctgatgttggatgggtagccaaagaagaaggagagtgttcagcaagactaaggacagaggtcagatcaaggccaccccttcaggatgaccttcttttctttgagaaggccccaagcagacagatttccttaccagacttgtctcaagaagagcctcagctgaagaccccagcgcgggcaaatgaggaagcactgcagaagatttgcgctctcgaaaatgaacttgctgctctcagagctcagattgccaaaattgtgacccagcaggagcagcaaaatctcactgcaggtgacttagattctaccacatttggtaccataccaccacaccctccacctcccccaccgcccctgcctccccctgcactggggctccaccaaagtacatctgctgttgatctgattaaagaacgaagagagaaaagagccaatgctggaaagactttggttaagaacaatccaaagaaacctgaaatgccaaatatgctagagatccttaaagagatgaacagtgtaaaacttcggtcagtgaagaggtcagagcaagatgtgaagcccaagccagtggatgctactgaccctgctgccctcatagcagaggctctgaaaaagaaatttgcttatcggtatcgaagtgatagccaagatgaagttgaaaaaggaattccaaagtctgaatcagaggccacctcagagagagtgttgtttgggccacacatgttgaagccaacaggaaaaatgaaggctttaattgaaaatgtatcagactcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - O-sialoglycoprotein endopeptidase
- coiled-coil domain containing 33
- carbohydrate sulfotransferase 10
- cyclin D-type binding-protein 1

Buy MTFR1-mitochondrial fission regulator 1 Gene now

Add to cart