Login to display prices
Login to display prices
CHST10-carbohydrate sulfotransferase 10 Gene View larger

CHST10-carbohydrate sulfotransferase 10 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHST10-carbohydrate sulfotransferase 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHST10-carbohydrate sulfotransferase 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010441
Product type: DNA & cDNA
Ncbi symbol: CHST10
Origin species: Human
Product name: CHST10-carbohydrate sulfotransferase 10 Gene
Size: 2ug
Accessions: BC010441
Gene id: 9486
Gene description: carbohydrate sulfotransferase 10
Synonyms: HNK-1ST; HNK1ST; carbohydrate sulfotransferase 10; HNK-1 sulfotransferase; huHNK-1ST
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaccaccagtggcttctgctggccgcatgcttttgggtgattttcatgttcatggtggctagcaagttcatcacgttgacctttaaagacccagatgtgtacagtgccaaacaggagtttctgttcctgacaaccatgccggaagtgaggaagttgccagaagagaagcacattcctgaggaactgaagccaactgggaaggagcttccagacagccagctcgttcagcccctggtctacatggagcgcctggaactcatcagaaacgtctgcagggatgatgccctgaagaatctctcgcacactcctgtctccaagtttgtcctggaccgaatatttgtctgtgacaagcacaagattcttttctgccagactcccaaagtgggcaacacccagtggaagaaagtgctgattgttctaaatggagcattttcttccattgaggagatccccgaaaacgtggtgcacgaccacgagaagaacggccttcctcggctctcttccttcagtgatgcagaaattcagaagcgattgaaaacatacttcaagttttttattgtaagagatcccttcgaaagacttatttctgcatttaaggataaatttgttcacaatccccggtttgagccttggtacaggcatgagattgctcctggcatcatcagaaaatacaggaggaaccggacagagacgcgggggatccagtttgaagatttcgtgcgctacctcggcgatccgaaccacagatggctagaccttcagtttggggaccacatcattcactgggtgacgtatgtagagctctgtgctccctgtgagataatgtacagtgtgattggacaccacgagaccctggaggacgatgccccatacatcttaaaagaggctggcattgaccacctggtgtcatacccgactatccctccgggcattaccgtgtataacagaaccaaggtggagcactatttcctgggcatcagcaaacgagacatccgacgcctgtatgcccgtttcgaaggggactttaagctctttgggtaccagaaaccagactttttgctaaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cyclin D-type binding-protein 1
- Cdk5 and Abl enzyme substrate 1
- LAG1 homolog, ceramide synthase 3
- LAG1 homolog, ceramide synthase 3