Login to display prices
Login to display prices
CABLES1-Cdk5 and Abl enzyme substrate 1 Gene View larger

CABLES1-Cdk5 and Abl enzyme substrate 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CABLES1-Cdk5 and Abl enzyme substrate 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CABLES1-Cdk5 and Abl enzyme substrate 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037218
Product type: DNA & cDNA
Ncbi symbol: CABLES1
Origin species: Human
Product name: CABLES1-Cdk5 and Abl enzyme substrate 1 Gene
Size: 2ug
Accessions: BC037218
Gene id: 91768
Gene description: Cdk5 and Abl enzyme substrate 1
Synonyms: CABL1; CABLES; HsT2563; IK3-1; CDK5 and ABL1 enzyme substrate 1; interactor with CDK3 1; Cdk5 and Abl enzyme substrate 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctttctaagaggggctgccatgcaagaatatatgctgattttcccatacggcgcctcatctcccagagatcttccttggagaccctggaagatattgaggagaacgcccctctccggagatgtcgaactctctcaggttcacccagaccaaagaattttaagaagattcattttatcaagaacatgcggcaacacgataccaggaatggcagaatagtccttatcagtggcagaagatccttctgtagtatattttcagtgctgccgtatcgcgacagtacccaagtcggggacttgaagttggacggaggaagacaatcaactggtgcagtgagtttgaaagagatcattggtctggaaggtgtggagctgggtgctgatgggaagactgtttcctatacccaatttctgttacccacaaatgcctttggagcccggagaaataccatagactccacctcctctttctcccagttccgtaacctgagccaccgcagcctctccataggccgggcaagcggcacccaggggagcctcgacacaggtagtgacctgggagactttatggactatgacccaaatctcttggatgacccccagtggccttgtggcaaacacaaacgcgttctgatcttcccttcctacatgacaacagtgattgactacgtgaagccctcggatctcaagaaggacatgaacgagaccttcaaggagaagtttcctcacattaagctgacactcagcaaaattaggagtctgaaacgagagatgcggaagcttgcgcaggaggactgtggccttgaggagcccacggtggccatggccttcgtctactttgaaaagctcgccctcaaggggaaactcaacaaacagaaccggaagctgtgtgctggggcatgtgtgctgttagcagccaaaattggaagtgacctcaaaaaacacgaagtcaagcatttaattgacaaactggaagagaagttccggctgaacaggcgagaactgattgcctttgaattcccggtgttagtggccttggaattcgccctccacttgcccgagcacgaagtcatgccccactacagacggctggtccagagttcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LAG1 homolog, ceramide synthase 3
- LAG1 homolog, ceramide synthase 3
- protein kinase C substrate 80K-H
- G protein-coupled receptor 137B