Login to display prices
Login to display prices
PRKCSH-protein kinase C substrate 80K-H Gene View larger

PRKCSH-protein kinase C substrate 80K-H Gene

PTXBC013586

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRKCSH-protein kinase C substrate 80K-H Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRKCSH-protein kinase C substrate 80K-H Gene

Proteogenix catalog: PTXBC013586
Ncbi symbol: PRKCSH
Product name: PRKCSH-protein kinase C substrate 80K-H Gene
Size: 2ug
Accessions: BC013586
Gene id: 5589
Gene description: protein kinase C substrate 80K-H
Synonyms: AGE-R2; G19P1; GIIB; PCLD; PCLD1; PKCSH; PLD1; VASAP-60; glucosidase 2 subunit beta; AGE-binding receptor 2; advanced glycation end-product receptor 2; glucosidase II subunit beta; hepatocystin; protein kinase C substrate 60.1 kDa protein heavy chain; protein kinase C substrate, 80 Kda protein; protein kinase C substrate 80K-H
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgaggtcacccgcgaagggttccgtctgaagaagatccttattgaggactggaagaaggcacgggaggagaagcagaaaaagctcattgagctacaggctgggaagaagtctctggaagaccaggtggagatgctgcggacagtgaaggaggaagctgagaagccagagagagaggccaaagagcagcaccagaagctgtgggaagagcagctggctgctgccaaggcccaacaggagcaggagctggcggctgatgccttcaaggagctggatgatgacatggacgggacggtctcggtgactgagctgcagactcacccggagctggacacagatggggatggggcgttgtcagaagcggaagctcaggccctcctcagtggggacacacagacagacgccacctctttctacgaccgcgtctgggccgccatcagggacaagtaccggtccgaggcactgcccaccgaccttccaacaccttctgcccctgacttgacggagcccaaggaggagcagccgccagtgccctcgtcgcccacagaggaggaggaggaggaggaggaggaggaagaagaggctgaagaagaggaggaggaggaggattccgaggaggccccaccgccactgtcacccccgcagccggccagccctgctgaggaagacaaaatgccgccctacgacgagcagacgcaggccttcatcgatgctgcccaggaggcccgcaacaagttcgaggaggccgagcggtcgctgaaggacatggaggagtccatcaggaacctggagcaagagatttcttttgactttggccccaacggggagtttgcttacctgtacagccagtgctacgagctcaccaccaacgaatacgtctaccgcctctgccccttcaagcttgtctcgcagaaacccaaactcgggggctctcccaccagccttggcacctggggctcatggattggccccgaccacgacaagttcagtgccatgaagtatgagcaaggcacgggctgctggcagggccccaaccgctccaccaccgtgcgcctcctgtgcgggaaagagaccatggtgaccagcaccacagagcccagtcgctgcgagtacctcatggagctgatgacgccagccgcctgcccggagccaccgcctgaagcacccaccgaagacgaccatgacgagctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: