OMG-oligodendrocyte myelin glycoprotein Gene View larger

OMG-oligodendrocyte myelin glycoprotein Gene

PTXBC018050

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OMG-oligodendrocyte myelin glycoprotein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about OMG-oligodendrocyte myelin glycoprotein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018050
Product type: DNA & cDNA
Ncbi symbol: OMG
Origin species: Human
Product name: OMG-oligodendrocyte myelin glycoprotein Gene
Size: 2ug
Accessions: BC018050
Gene id: 4974
Gene description: oligodendrocyte myelin glycoprotein
Synonyms: OMGP; oligodendrocyte-myelin glycoprotein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatatcagatattgaaaatgtctctctgcctgttcatccttctgtttctcacacctggtattttatgcatttgtcctctccaatgtatatgcacagagaggcacaggcatgtggactgttcaggcagaaacttgtctacattaccatctggactgcaagagaatattatacatttaaacctgtcttataaccactttactgatctgcataaccagttaacccaatataccaatctgaggaccctggacatttcaaacaacaggcttgaaagcctgcctgctcacttacctcggtctctgtggaacatgtctgctgctaacaacaacattaaacttcttgacaaatctgatactgcttatcagtggaatcttaaatatctggatgtttctaagaacatgctggaaaaggttgtcctcattaaaaatacactaagaagtctcgaggttctcaacctcagtagtaacaaactttggacagttccaaccaacatgccctccaaactacatatcgtggacctgtctaataattctttgacacaaattcttccaggtacattaataaacctgacaaatctcacacatctttacctgcacaacaataagttcacattcattccagaccaatcttttgaccaactctttcagttgcaagagataaccctttacaataacaggtggtcatgtgaccacaaacaaaacattacttacttactgaagtggatgatggaaacaaaagcccatgtgatagggactccatgttctacccaaatatcatctttaaaggaacataacatgtatcccacaccttctggatttacctcaagcttattcactgtaagtgggatgcagacagtggacaccattaactctctgagtgtggtaactcaacccaaagtgaccaaaatacccaaacaatatcgaacaaaggaaacaacgtttggtgccactctaagcaaagacaccacctttactagcactgataaggcttttgtgccctatccagaagatacatccacagagactatcaattcacatgaagcagcagctgcaactctaactattcatctccaagatggaatggtcacaaacacaagcctcactagctcaacaaaatcatccccaacacccatgaccctaagtatcactagtggcatgccaaataatttctctgaaatgcctcaacaaagcacaacccttaacttatggagggaagagacaaccacaaatgtaaagactccattaccttctgtggcaaatgcttggaaagtaaatgcttcatttctcttattgctcaatgttgtggtcatgctggctgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein-coupled receptor 172A
- fibrinogen C domain containing 1
- coiled-coil domain containing 71
- dual oxidase maturation factor 1

Buy OMG-oligodendrocyte myelin glycoprotein Gene now

Add to cart