Login to display prices
Login to display prices
GPR172A-G protein-coupled receptor 172A Gene View larger

GPR172A-G protein-coupled receptor 172A Gene

PTXBC002917

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR172A-G protein-coupled receptor 172A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPR172A-G protein-coupled receptor 172A Gene

Proteogenix catalog: PTXBC002917
Ncbi symbol: GPR172A
Product name: GPR172A-G protein-coupled receptor 172A Gene
Size: 2ug
Accessions: BC002917
Gene id: 79581
Gene description: G protein-coupled receptor 172A
Synonyms: GPR172A; BVVLS2; D15Ertd747e; GPCR41; PAR1; RFT3; RFVT2; hRFT3; solute carrier family 52, riboflavin transporter, member 2; G protein-coupled receptor 172A; PERV-A receptor 1; porcine endogenous retrovirus A receptor 1; riboflavin transporter 3; solute carrier family 52 (riboflavin transporter), member 2; solute carrier family 52 member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcacccacgcccgcccgtccggtgctgacccacctgctggtggctctcttcggcatgggctcctgggctgcggtcaatgggatctgggtggagctacctgtggtggtcaaagagcttccagagggttggagcctcccctcttacgtctctgtgcttgtggctctggggaacctgggtctgctggtggtgaccctctggaggaggctggccccaggaaaggacgagcaggtccccatccgggtggtgcaggtgctgggcatggtgggcacagccctgctggcctctctgtggcaccatgtggccccagtggcaggacagttgcattctgtggccttcttagcactggcctttgtgctggcactggcatgctgtgcctcgaatgtcactttcctgcccttcttgagccacctgccacctcgcttcttacggtcattcttcctgggtcaaggcctgagtgccctgctgccctgcgtgctggccctagtgcagggtgtgggccgcctcgagtgcccgccagcccccatcaacggcacccctggccccccgctcgacttccttgagcgttttcccgccagcaccttcttctgggcactgactgcccttctggtcgcttcagctgctgccttccagggtcttctgctgctgttgccgccaccaccatctgtacccacaggggagttaggatcaggcctccaggtgggagccccaggagcagaggaagaggtggaagagtcctcaccactgcaagagccaccaagccaggcagcaggcaccacccctggtccagaccctaaggcctatcagcttctatcagcccgcagtgcctgcctgctgggcctgttggccgccaccaacgcgctgaccaatggcgtgctgcctgccgtgcagagcttttcctgcttaccctacgggcgtctggcctaccacctggctgtggtgctgggcagtgctgccaatcccctggcctgcttcctggccatgggtgtgctgtgcaggtccttggcagggctgggcggcctctctctgctgggcgtgttctgtgggggctacctgatggcgctggcagtcctgagcccctgcccgcccctggtgggcacctcggcgggggtggtcctcgtggtgctgtcgtgggtgctgtgtcttggcgtgttctcctacgtgaaggtggcagccagctccctgctgcatggcgggggccggccggcattgctggcagccggcgtggccatccaggtgggctctctgctcggcgctgttgctatgttccccccgaccagcatctatcacgtgttccacagcagaaaggactgtgcagacccctgtgactcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: