CCNDBP1-cyclin D-type binding-protein 1 Gene View larger

CCNDBP1-cyclin D-type binding-protein 1 Gene

PTXBC009689

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCNDBP1-cyclin D-type binding-protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCNDBP1-cyclin D-type binding-protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009689
Product type: DNA & cDNA
Ncbi symbol: CCNDBP1
Origin species: Human
Product name: CCNDBP1-cyclin D-type binding-protein 1 Gene
Size: 2ug
Accessions: BC009689
Gene id: 23582
Gene description: cyclin D-type binding-protein 1
Synonyms: DIP1; GCIP; HHM; cyclin-D1-binding protein 1; D-type cyclin-interacting protein 1; cyclin D-type binding-protein 1; grap2 and cyclin-D-interacting protein; human homolog of Maid; cyclin D1 binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgagcgcaactgcacctgcagccgcagtccccaccctggcttcgcctttggagcagctccggcacttggcggaggagctgcggttgctcctgcctcgagtgcgggtcggcgaagcccaggagaccaccgaggagtttaatcgagagatgttctggagaagactcaatgaggcagctgtgactgtgtcaagggaagccacgactctgaccatagtcttctctcagcttccactgccgtctccacaggaaacccagaagttctgtgaacaagtccatgctgccatcaaggcatttattgcagtgtactatttgcttccaaaggatcaggggatcaccctgagaaagctggtacggggcgccaccctggacatcgtggatggcatggctcagctcatggaagtactttccgtcactccaactcagagccctgagaacaatgaccttatttcctacaacagtgtctgggttgcgtgccagcagatgcctcagataccaagagataacaaagctgcagctcttttgatgctgaccaagaatgtggattttgtgaaggatgcacatgaagaaatggagcaggctgtggaagaatgtgacccttactctggcctcttgaatgatactgaggagaacaactctgacaaccacaatcatgaggatgatgtgttggggtttcccagcaatcaggacttgtattggtcagaggacgatcaagagctcataatcccatgccttgcgctggtgagagcatccaaagcctgcctgaagaaaattcggatgttagtggcagagaatgggaagaaggatcaggtggcacagctggatgacattgtggatatttctgatgaaatcagccctagtgtggatgatttggctctgagcatatatccacctatgtgtcacctgaccgtgcgaatcaattctgcgaaacttgtatctgttttaaagaaggcacttgaaattacaaaagcaagtcatgtgacccctcagccagaagatagttggatccctttacttattaatgccattgatcattgcatgaatagaatcaaggagctcactcagagtgaacttgaattatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Cdk5 and Abl enzyme substrate 1
- LAG1 homolog, ceramide synthase 3
- LAG1 homolog, ceramide synthase 3
- protein kinase C substrate 80K-H

Buy CCNDBP1-cyclin D-type binding-protein 1 Gene now

Add to cart