Login to display prices
Login to display prices
RIBC2-RIB43A domain with coiled-coils 2 Gene View larger

RIBC2-RIB43A domain with coiled-coils 2 Gene

PTXBC003024

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RIBC2-RIB43A domain with coiled-coils 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RIBC2-RIB43A domain with coiled-coils 2 Gene

Proteogenix catalog: PTXBC003024
Ncbi symbol: RIBC2
Product name: RIBC2-RIB43A domain with coiled-coils 2 Gene
Size: 2ug
Accessions: BC003024
Gene id: 26150
Gene description: RIB43A domain with coiled-coils 2
Synonyms: C22orf11; TRIB; RIB43A-like with coiled-coils protein 2; RIB43A domain with coiled-coils 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggcaaaatgacaaaatcatgtgcatattggaaaaccggaaaaagagggataggaaaaatctctgtagggctatcaatgacttccaacagagctttcagaagccagaaactcgccgtgaatttgatctgtccgaccccctagcccttaagaaagatcttccagcccggcagtcagataatgatgttcggaatacgatatcaggaatgcagaaattcatgggagaggatttaaacttccatgagaggaagaaattccaagaggaacaaaacagagaatggtctttgcagcagcaaagggaatggaagaacgcccgtgctgaacaaaaatgcgcagaggccctctacacagagacaaggctgcagtttgacgagacagccaagcacctccagaagctggaaagcaccaccagaaaggcagtttgtgcatctgtgaaagacttcaacaagagccaggccatcgagtcagtggaaaggaaaaagcaagagaaaaagcaagaacaagaggacaacttggccgagatcaccaacctcctgcgtggggacctgctctccgagaacccgcagcaggcagccagctccttcgggccccaccgcgtggtccctgaccgctggaagggcatgacccaggagcagctggagcagatccgcctagtccagaagcagcaaatccaggagaagctgaggctccaggaagaaaagcgccagcgagacctggactgggaccggcggaggattcagggggctcgcgccaccctgctgtttgagcggcagcagtggcggcggcagcgcgacctgcgcagagctctggacagcagcaacctcagcctggccaaggagcagcatttgcagaaaaaatatatgaatgaagtctatacaaatcaacccacgggagactatttcacacaatttaatacaggaagtcgataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: