Login to display prices
Login to display prices
CCDC51-coiled-coil domain containing 51 Gene View larger

CCDC51-coiled-coil domain containing 51 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC51-coiled-coil domain containing 51 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC51-coiled-coil domain containing 51 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004341
Product type: DNA & cDNA
Ncbi symbol: CCDC51
Origin species: Human
Product name: CCDC51-coiled-coil domain containing 51 Gene
Size: 2ug
Accessions: BC004341
Gene id: 79714
Gene description: coiled-coil domain containing 51
Synonyms: coiled-coil domain-containing protein 51; coiled-coil domain containing 51
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggctcgagggcttgtccgagaggctcgggaggacttggaagttcaccaggccaagctgaaggaggtgagggaccgcttggaccgtgtctccagggaggacagtcagtacttggaactggctactctcgagcacaggatgctgcaggaggagaagaggcttcgcacagcctatctgcgtgcagaagactctgagcgagagaagttctccctcttctctgcagctgtgcgggaaagtcatgagaaggagcgcacaagggctgagaggaccaagaactggtccctcattggctcagtcctgggggccctgattggtgtggctggctccacctatgtgaaccgtgtgcgactacaggagctgaaggctttactcctggaggcgcagaaggggcctgtgagtctccaagaggccattcgagaacaggcgtctagctactcccgccagcagagggacctccacaatctcatggtggacctgaggggcctggtacatgctgctgggccagggcaggactctgggtcacaggcaggtagtcccccgaccagagacagagatgtagatgtcctttcagctgccttgaaagagcagcttagtcattccaggcaagtccattcatgtctagaaggcttacgagagcagcttgatggcctagaaaagacttgtagccaaatggctggggtggttcagcttgtaaagtctgcagcacacccaggcctggtggaaccagcagacggggctatgcccagcttcttgctggagcaggggagcatgatcttggcactgtcagacacggagcagagactagaagcccaagtcaacaggaacaccatctatagcaccctggtcacctgtgtgacatttgtggccacactgcctgtgctctacatgctattcaaagccagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - amyloid beta (A4) precursor protein
- RIB43A domain with coiled-coils 2
- coiled-coil domain containing 92
- 3-ketodihydrosphingosine reductase