NRBF2-nuclear receptor binding factor 2 Gene View larger

NRBF2-nuclear receptor binding factor 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NRBF2-nuclear receptor binding factor 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NRBF2-nuclear receptor binding factor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011707
Product type: DNA & cDNA
Ncbi symbol: NRBF2
Origin species: Human
Product name: NRBF2-nuclear receptor binding factor 2 Gene
Size: 2ug
Accessions: BC011707
Gene id: 29982
Gene description: nuclear receptor binding factor 2
Synonyms: COPR; COPR1; COPR2; NRBF-2; nuclear receptor-binding factor 2; comodulator of PPAR and RXR 1; comodulator of PPAR and RXR 2; nuclear receptor binding factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagtaatggaaggacccctcaacctggctcatcaacagagcagacgagcagaccgtttattagctgcaggcaaatacgaagaggctatttcttgtcacaaaaaggctgcagcatatctttctgaagccatgaagctgacacagtcagagcaggctcatctttcactggaattgcaaagggatagccatatgaaacagctcctcctcatccaagagagatggaaaagggcccagcgtgaagaaagattgaaagcccagcagaacacagacaaggatgcagctgcccatcttcagacatctcacaaaccctctgcagaggatgcagagggccagagtcccctttctcagaagtacagcccttccacagagaaatgcctgcctgagattcaggggatctttgacagggatccagacacactactttatttacttcagcaaaagagtgagccagcagagccatgtattggaagcaaagccccaaaagatgataaaacaattatagaggagcaggcaaccaaaattgcagatttgaagaggcatgtggaattccttgtggctgagaatgaaagattaaggaaagaaaataaacaactaaaggctgaaaaggccagacttctaaaaggtccaatagaaaaggagctggatgtagatgctgattttgtagaaacgtcagagttatggagcttgccaccacatgcagaaactgctacagcctcctcaacctggcagaagttcgcagcaaatactgggaaagccaaggacattccaatccccaatcttcctcccttggattttccatctccagaacttcctcttatggagctctctgaggatattctgaaaggatttatgaataattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myelin oligodendrocyte glycoprotein
- coiled-coil domain containing 51
- amyloid beta (A4) precursor protein
- RIB43A domain with coiled-coils 2

Buy NRBF2-nuclear receptor binding factor 2 Gene now

Add to cart