Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FHL5-four and a half LIM domains 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FHL5-four and a half LIM domains 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021723 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FHL5 |
| Origin species: | Human |
| Product name: | FHL5-four and a half LIM domains 5 Gene |
| Size: | 2ug |
| Accessions: | BC021723 |
| Gene id: | 9457 |
| Gene description: | four and a half LIM domains 5 |
| Synonyms: | 1700027G07Rik; ACT; FHL-5; dJ393D12.2; four and a half LIM domains protein 5; LIM protein ACT; activator of cAMP-responsive element modulator (CREM) in testis; activator of cAMP-responsive element modulator in testis; four and a half LIM domains 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacaactgctcacttttactgtcaatactgcacagcatcacttcttgggaagaaatatgtactaaaggatgacagtccatactgtgttacatgttatgatcgtgtattttctaactattgcgaggaatgcaaaaaaccaattgaatctgattctaaggatctttgttacaaagaccggcactggcatgaaggatgcttcaagtgcaccaaatgcaatcactctttggtggaaaagccttttgctgccaaggatgagcgcctgctgtgcacggagtgctattctaacgagtgctcctccaagtgcttccactgcaagaggaccatcatgcctggttcccgcaaaatggaatttaagggaaactactggcatgaaacctgttttgtgtgtgagaattgccgacaacctatagggacaaagcctttgatctccaaagagagtggcaattattgtgtgccatgttttgagaaggagtttgctcactactgcaacttttgtaagaaggtgataacttcaggtgggataacattttgtgaccagctatggcataaagagtgttttctgtgtagtgactgtaggaaagatctctgtgaagaacagttcatgtccagagacgactatccattctgcatggactgctacaaccatctttatgccaacaagtgtgtagcctgttccaaacccattagtggtctcacaggtgccaagtttatctgctttcaagacagccagtggcatagcgaatgctttaactgcgggaaatgctctgtctccttggtgggtaaaggcttcctgacccagaacaaggaaatcttctgccaaaaatgtggctccggaatggacactgacatctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - E2F-associated phosphoprotein - heme oxygenase (decycling) 1 - translin-associated factor X - sperm acrosome associated 1 |