FHL5-four and a half LIM domains 5 Gene View larger

FHL5-four and a half LIM domains 5 Gene

PTXBC021723

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FHL5-four and a half LIM domains 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FHL5-four and a half LIM domains 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021723
Product type: DNA & cDNA
Ncbi symbol: FHL5
Origin species: Human
Product name: FHL5-four and a half LIM domains 5 Gene
Size: 2ug
Accessions: BC021723
Gene id: 9457
Gene description: four and a half LIM domains 5
Synonyms: 1700027G07Rik; ACT; FHL-5; dJ393D12.2; four and a half LIM domains protein 5; LIM protein ACT; activator of cAMP-responsive element modulator (CREM) in testis; activator of cAMP-responsive element modulator in testis; four and a half LIM domains 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaactgctcacttttactgtcaatactgcacagcatcacttcttgggaagaaatatgtactaaaggatgacagtccatactgtgttacatgttatgatcgtgtattttctaactattgcgaggaatgcaaaaaaccaattgaatctgattctaaggatctttgttacaaagaccggcactggcatgaaggatgcttcaagtgcaccaaatgcaatcactctttggtggaaaagccttttgctgccaaggatgagcgcctgctgtgcacggagtgctattctaacgagtgctcctccaagtgcttccactgcaagaggaccatcatgcctggttcccgcaaaatggaatttaagggaaactactggcatgaaacctgttttgtgtgtgagaattgccgacaacctatagggacaaagcctttgatctccaaagagagtggcaattattgtgtgccatgttttgagaaggagtttgctcactactgcaacttttgtaagaaggtgataacttcaggtgggataacattttgtgaccagctatggcataaagagtgttttctgtgtagtgactgtaggaaagatctctgtgaagaacagttcatgtccagagacgactatccattctgcatggactgctacaaccatctttatgccaacaagtgtgtagcctgttccaaacccattagtggtctcacaggtgccaagtttatctgctttcaagacagccagtggcatagcgaatgctttaactgcgggaaatgctctgtctccttggtgggtaaaggcttcctgacccagaacaaggaaatcttctgccaaaaatgtggctccggaatggacactgacatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - E2F-associated phosphoprotein
- heme oxygenase (decycling) 1
- translin-associated factor X
- sperm acrosome associated 1

Buy FHL5-four and a half LIM domains 5 Gene now

Add to cart