Login to display prices
Login to display prices
HMOX1-heme oxygenase (decycling) 1 Gene View larger

HMOX1-heme oxygenase (decycling) 1 Gene

PTXBC001491

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HMOX1-heme oxygenase (decycling) 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HMOX1-heme oxygenase (decycling) 1 Gene

Proteogenix catalog: PTXBC001491
Ncbi symbol: HMOX1
Product name: HMOX1-heme oxygenase (decycling) 1 Gene
Size: 2ug
Accessions: BC001491
Gene id: 3162
Gene description: heme oxygenase (decycling) 1
Synonyms: HMOX1D; HSP32; bK286B10; heme oxygenase 1; heat shock protein, 32-kD; heme oxygenase (decycling) 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcgtccgcaacccgacagcatgccccaggatttgtcagaggccctgaaggaggccaccaaggaggtgcacacccaggcagagaatgctgagttcatgaggaactttcagaagggccaggtgacccgagacggcttcaagctggtgatggcctccctgtaccacatctatgtggccctggaggaggagattgagcgcaacaaggagagcccagtcttcgcccctgtctacttcccagaagagctgcaccgcaaggctgccctggagcaggacctggccttctggtacgggccccgctggcaggaggtcatcccctacacaccagccatgcagcactatgtgaagcggctccacgaggtggggcgcacagagcccgagctgctggtggcccacgcctacacccgctacctgggtgacctgtctgggggccaggtgctcaaaaagattgcccagaaagccctggacctgcccagctctggcgagggcctggccttcttcaccttccccaacattgccagtgccaccaagttcaagcagctctaccgctcccgcatgaactccctggagatgactcccgcagtcaggcagagggtgatagaagaggccaagactgcgttcctgctcaacatccagctctttgaggagttgcaggagctgctgacccatgacaccaaggaccagagcccctcacgggcaccagggcttcgccagcgggccagcaacaaagtgcaagattctgcccccgtggagactcccagagggaagcccccactcaacacccgctcccaggctccgcttctccgatgggtccttacactcagctttctggtggcgacagttgctgtagggctttatgccatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: