TSNAX-translin-associated factor X Gene View larger

TSNAX-translin-associated factor X Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSNAX-translin-associated factor X Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSNAX-translin-associated factor X Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010376
Product type: DNA & cDNA
Ncbi symbol: TSNAX
Origin species: Human
Product name: TSNAX-translin-associated factor X Gene
Size: 2ug
Accessions: BC010376
Gene id: 7257
Gene description: translin-associated factor X
Synonyms: translin-associated protein X; translin-like protein; translin associated factor X
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcaacaaagaaggatcaggagggttcaggaaaaggaagcatgacaatttcccacataaccaaagaagagaagggaaggatgttaattcatcttcacccgtgatgttggcctttaaatcatttcagcaggaacttgatgcaaggcatgacaaatatgagagacttgtgaaacttagtcgggatataactgttgaaagtaaaaggacaatttttctcctccataggattacaagtgctcctgatatggaagatatattgactgaatcagaaattaaattggatggtgtcagacaaaagatattccaggtagcccaagagctatcaggggaagatatgcatcagttccatcgagccattactacaggactacaggaatatgtggaagctgtctcttttcaacacttcatcaaaacacgatcattaattagtatggatgaaattaataaacaattgatatttacgactgaagacaatgggaaagaaaataaaactccctcctctgatgcacaggataagcagtttggtacttggagactgagagtcacacctgtcgattaccttctgggagtggctgacttaactggagaattgatgcggatgtgtattaacagtgtggggaatggggacattgataccccctttgaagtgagccagtttttacgtcaggtttatgatgggttttcattcattggcaacactggaccttacgaggtttctaagaagctgtataccttgaaacaaagtttggccaaagtggagaatgcttgttatgccttgaaagtcagagggtcagaaattccaaaacatatgttggcagatgtgttttcagttaaaacagaaatgatagatcaagaagagggcatttcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sperm acrosome associated 1
- TIMELESS interacting protein
- pecanex-like 2 (Drosophila)
- ribosomal protein, large, P0

Buy TSNAX-translin-associated factor X Gene now

Add to cart