Login to display prices
Login to display prices
PCNXL2-pecanex-like 2 (Drosophila) Gene View larger

PCNXL2-pecanex-like 2 (Drosophila) Gene

PTXBC008300

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCNXL2-pecanex-like 2 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PCNXL2-pecanex-like 2 (Drosophila) Gene

Proteogenix catalog: PTXBC008300
Ncbi symbol: PCNXL2
Product name: PCNXL2-pecanex-like 2 (Drosophila) Gene
Size: 2ug
Accessions: BC008300
Gene id: 80003
Gene description: pecanex-like 2 (Drosophila)
Synonyms: PCNXL2; pecanex-like protein 2; pecanex homolog 2 (Drosophila)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgttttttggtggttctgctgtgtctgggataacctcggctgtttacagtgtggcccggagcgtcttggctgccgccctgctccacgcagtctgcttcagtgcagtgaaggaaccgtggagcatgcaacacatcccggcactgttttcggccttctgtggcctcttggtcgccctttcttaccatctgagccgtcagagcagtgacccatctgtactcatgtccttcatccaatgcaggctgtttcctaaatttttacatcaaaatctggcagagtcagctgctgaccctctccccaagaagatgaaagattcagtgacggatgtcttaaaatgggatctcatcgtctgcgcagtggttgctgtcctctcatttgcagtcagcgccagcactgtattcctgtcattgcgaccatttctcagcatcgtgctgtttgccttggctggagccgtggggtttgtaacacattacgtgctccctcagctccgcaagcatcatccctggatgtggatttcacaccccattctcaaaaacaaagagtatcatcaacgggaagtgagagatgttgcccatttaatgtggttcgaaagactctatgtttggcttcagtgttttgaaaaatacatcttgtacccagcgctaattttgaatgccctcactattgatgcatttttaataagcaatcaccggagacttggtacccactgggacatttttctgatgatcattgctggcatgaagctgttgcggacatcattctgcaacccggtttaccagtttattaacttgagcttcactgtcatctttttccactttgactacaaagatatttcagagagcttcttactggatttcttcatggtgtccattttatttagcaaggtgtttctgggctacgtgaggcaaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: