PTXBC000277
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000277 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RICS |
| Origin species: | Human |
| Product name: | RICS-Rho GTPase-activating protein Gene |
| Size: | 2ug |
| Accessions: | BC000277 |
| Gene id: | 9743 |
| Gene description: | Rho GTPase-activating protein |
| Synonyms: | rho/Cdc42/Rac GTPase-activating protein RICS; RICS; PX-RICS; GC-GAP; GRIT; p200RhoGAP; p250GAP; rho GTPase-activating protein 32; GAB-associated CDC42; GAB-associated Cdc42/Rac GTPase-activating protein; GTPase regulator interacting with TrkA; GTPase-activating protein for Cdc42 and Rac1; RhoGAP involved in the -catenin-N-cadherin and NMDA receptor signaling; brain-specific Rho GTP-ase-activating protein; brain-specific Rho GTPase-activating protein; rac GTPase activating protein; rho-type GTPase-activating protein 32; rhoGAP involved in the beta-catenin-N-cadherin and NMDA receptor signaling; Rho GTPase activating protein 32 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccccgaaagtgttaagcacatggtggagaggcaagcacggattccaggtgggactcttccctggacactgtgttgagttaattaaccaaaaagttccccagtcagtgaccaactcagtgccaaaaccagtgtctaaaaagcacggcaagctcattacgttcttacgaacattcatgaagtctcgtccaacaaaacagaagctgaagcagcggggaatcttgaaagagagggtgtttggttgtgacctgggggagcaccttctaaattctggttttgaagtgccgcaggttcttcaaagctgcacagcattcattgagagatatggcatcgtggatggaatctatcgcctttctggtgttgcctccaatatccagagactacgccatgaatttgactctgagcacgtccccgacctgacgaaagaaccgtatgttcaggacatccattctgtgggttccctatgtaagctgtacttccgggaactcccaaaccctctgcttacctaccagctgtatgagaaattttctgatgcagtttcagcagcaacagatgaagaaaggctgataaaaatccacgatgtcatccagcagctccccccaccacactacagaacactggagttcctgatgagacacttgtctcttctagctgactattgttccatcacaaatatgcatgcaaaaaatctagcaattgtttgggctccaaacctgttaagatcaaaacagatagaatctgcctgcttcagtggaacagcagctttcatggaagtgaggattcagtctgtggttgttgagttcatcctgaatcacgttgatgtgctgctgccacacttcagcgcacgcacagaactaatcgtccccttccccctccgccttctcagaaaacagtttactcctcctttgctaggcccgatgtcaccactgaaccctttggtccagataactgtttgcatttcaatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - fructose-1,6-bisphosphatase 1 - polycomb group ring finger 2 - Yip1 domain family, member 3 - polycomb group ring finger 6 |