FBP1-fructose-1,6-bisphosphatase 1 Gene View larger

FBP1-fructose-1,6-bisphosphatase 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FBP1-fructose-1,6-bisphosphatase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FBP1-fructose-1,6-bisphosphatase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012927
Product type: DNA & cDNA
Ncbi symbol: FBP1
Origin species: Human
Product name: FBP1-fructose-1,6-bisphosphatase 1 Gene
Size: 2ug
Accessions: BC012927
Gene id: 2203
Gene description: fructose-1,6-bisphosphatase 1
Synonyms: FBP; fructose-1,6-bisphosphatase 1; D-fructose-1,6-bisphosphate 1-phosphohydrolase 1; FBPase 1; growth-inhibiting protein 17; liver FBPase; fructose-bisphosphatase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgaccaggcgcccttcgacacggacgtcaacaccctgacccgcttcgtcatggaggagggcaggaaggcccgcggcacgggcgagttgacccagctgctcaactcgctctgcacagcagtcaaagccatctcttcggcggtgcgcaaggcgggcatcgcgcacctctatggcattgctggttctaccaacgtgacaggtgatcaagttaagaagctggacgtcctctccaacgacctggttatgaacatgttaaagtcatcctttgccacgtgtgttctcgtgtcagaagaagataaacacgccatcatagtggaaccggagaaaaggggtaaatatgtggtctgttttgatccccttgatggatcttccaacatcgattgccttgtgtccgttggaaccatttttggcatctatagaaagaaatcaactgatgagccttctgagaaggatgctctgcaaccaggccggaacctggtggcagccggctacgcactgtatggcagtgccaccatgctggtccttgccatggactgtggggtcaactgcttcatgctggacccggccatcggggagttcattttggtggacaaggatgtgaagataaaaaagaaaggtaaaatctacagccttaacgagggctacgccagggactttgaccctgccgtcactgagtacatccagaggaagaagttccccccagataattcagctccttatggggcccggtatgtgggctccatggtggctgatgttcatcgcactctggtctacggagggatatttctgtaccccgctaacaagaagagccccaatggaaagctgagactgctgtacgaatgcaaccccatggcctacgtcatggagaaggctgggggaatggccaccactgggaaggaggccgtgttagacgtcattcccacagacattcaccagagggcgccggtgatcttgggatcccccgacgacgtgctcgagttcctgaaggtgtatgagaagcactctgcccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - polycomb group ring finger 2
- Yip1 domain family, member 3
- polycomb group ring finger 6
- kelch domain containing 8B

Buy FBP1-fructose-1,6-bisphosphatase 1 Gene now

Add to cart