EAPP-E2F-associated phosphoprotein Gene View larger

EAPP-E2F-associated phosphoprotein Gene

PTXBC001245

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EAPP-E2F-associated phosphoprotein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EAPP-E2F-associated phosphoprotein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001245
Product type: DNA & cDNA
Ncbi symbol: EAPP
Origin species: Human
Product name: EAPP-E2F-associated phosphoprotein Gene
Size: 2ug
Accessions: BC001245
Gene id: 55837
Gene description: E2F-associated phosphoprotein
Synonyms: BM036; C14orf11; E2F-associated phosphoprotein; E2F associated phosphoprotein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccggcttccggatgactacgacccctacgcggttgaagagcctagcgacgaggagccggctttgagcagctctgaggatgaagtggatgtgcttttacatggaactcctgaccaaaaacgaaaactcatcagagaatgtcttaccggagaaagtgaatcatctagtgaagatgaatttgaaaaggagatggaagctgaattaaattctaccatgaaaacaatggaggacaagttatcctctctgggaactggatcttcctcaggaaatggaaaagttgcaacagctccgacaaggtactacgatgatatatattttgattctgattccgaggatgaagacagagcagtacaggtgaccaagaaaaaaaagaagaaacaacacaagattccaacaaatgacgaattactgtatgatcctgaaaaagataacagagatcaggcctgggttgatgcacagagaaggggttaccatggtttgggaccacagagatcacgtgaacaacagcctgttccaaatagtgatgctgtcttgaattgtcctgcctgcatgaccacactttgccttgattgccaaaggcatgaatcatacaaaactcaatatagagcaatgtttgtaatgaattgttctattaacaaagaggaggttctaagatataaagcctcagagaacaggaagaaaaggcgggtccataagaagatgaggtctaaccaggaagatgctgctgagaaggcagagacagatgtggaagaaatctatcacccagtcatgtgcactgaatgttccactgaagtggcagtctacgacaaggatgaagtctttcattttttcaatgttttagcaagccattcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heme oxygenase (decycling) 1
- translin-associated factor X
- sperm acrosome associated 1
- TIMELESS interacting protein

Buy EAPP-E2F-associated phosphoprotein Gene now

Add to cart