LIX1-Lix1 homolog (chicken) Gene View larger

LIX1-Lix1 homolog (chicken) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LIX1-Lix1 homolog (chicken) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LIX1-Lix1 homolog (chicken) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036467
Product type: DNA & cDNA
Ncbi symbol: LIX1
Origin species: Human
Product name: LIX1-Lix1 homolog (chicken) Gene
Size: 2ug
Accessions: BC036467
Gene id: 167410
Gene description: Lix1 homolog (chicken)
Synonyms: Lix1 homolog; C5orf11; Lft; protein limb expression 1 homolog; Lowfat homolog; limb expression 1; limb and CNS expressed 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacataaccttggaatctctgagacacatcattgcccaagtcttgcctcacagagatccggctctagtcttcaaagacttgaacgttgtgtcaatgttacaggaattttgggaaagcaagcagcagcagaaggctgcattcccaagtgaaggtgtggtggtctatgagtcactgccagctcctgggcctccctttgtgagttacgtgaccctcccagggggaagctgttttggcaactttcagtgctgcttaagtagagccgaggccaggcgggatgcagctaaagtggccctgatcaactccctcttcaatgagctgccctctcgcaggatcaccaaggaattcattatggaaagtgttcaggaagcagtagcctccaccagcggcaccttagatgatgcagatgaccccagcaccagtgttggggcctatcactacatgctggagtcaaacatggggaagactatgctggagtttcaggagctgatgaccattttccaactattgcactggaatggaagcctaaaagcccttcgtgaaacaaagtgttcccgacaggaagtcatctcctactattctcagtattctctagatgaaaagatgcgcagccacatggccctggactggatcatgaaggagcgggactcaccaggaattgtctctcaagagctacgaatggccctgaggcagttggaggaagccaggaaagcaggacaagaactacggttttacaaagaaaagaaagaaatattgagcttagccctgactcagatctgcagtgaccctgacacttcctcacccagtgatgatcagctgagccttacggccctgtgtggctatcactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - distal-less homeobox 5
- PHD finger protein 11
- hepatic leukemia factor
- mesenchyme homeobox 2

Buy LIX1-Lix1 homolog (chicken) Gene now

Add to cart