Login to display prices
Login to display prices
PHF11-PHD finger protein 11 Gene View larger

PHF11-PHD finger protein 11 Gene

PTXBC017212

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PHF11-PHD finger protein 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PHF11-PHD finger protein 11 Gene

Proteogenix catalog: PTXBC017212
Ncbi symbol: PHF11
Product name: PHF11-PHD finger protein 11 Gene
Size: 2ug
Accessions: BC017212
Gene id: 51131
Gene description: PHD finger protein 11
Synonyms: APY; BCAP; IGEL; IGER; IGHER; NY-REN-34; NYREN34; PHD finger protein 11; BRCA1 C-terminus-associated protein; IgE responsiveness (atopic); renal carcinoma antigen NY-REN-34
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaaaaaggacatgtgcactctgccccaaagatgtcgaatataatgtcctgtactttgcacaatcagagaatatagctgctcatgagaattgtttgctgtattcttcaggacttgtggaatgtgaggatcaggatccacttaatcctgatagaagttttgatgtggaatcagtaaagaaagaaatccagagaggaaggaagttgaaatgcaaattttgtcataaaagaggagccaccgtgggatgtgatttaaaaaactgtaacaagaattaccactttttctgtgccaagaaggacgacgcagttccacagtctgatggagttcgaggaatttataaactgctttgccagcaacatgctcaattcccgatcatcgctcaaagtgctaaattttcaggagtgaaaagaaaaagaggaaggaagaaacccctctcaggcaatcatgtacagccacccgaaacaatgaaatgtaatacattcataagacaagtgaaagaagagcatggcagacacacagatgcaactgtgaaagttccttttcttaagaaatgcaaggaagcaggacttcttaattacttacttgaagaaatattagacaaagttcattcaattccagaaaaactcatggatgagactacttcagaatcagactatgaagaaatcgggagtgcactttttgactgtagattgttcgaagacacatttgtaaattttcaagcagcaatagagaaaaaaattcatgcatctcaacaaaggtggcagcagttgaaggaagagattgagctacttcaggacttaaaacaaaccttgtgctcttttcaagaaaatagagatcttatgtcaagttctacatcaatatcatccctgtcttattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: