MEOX2-mesenchyme homeobox 2 Gene View larger

MEOX2-mesenchyme homeobox 2 Gene

PTXBC017021

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MEOX2-mesenchyme homeobox 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MEOX2-mesenchyme homeobox 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017021
Product type: DNA & cDNA
Ncbi symbol: MEOX2
Origin species: Human
Product name: MEOX2-mesenchyme homeobox 2 Gene
Size: 2ug
Accessions: BC017021
Gene id: 4223
Gene description: mesenchyme homeobox 2
Synonyms: GAX; MOX2; homeobox protein MOX-2; growth arrest-specific homeobox; mesenchyme homeobox 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacacccgctctttggctgcctgcgcagccctcacgccacggcgcaaggcttgcacccgttctcccaatcctctctcgccctccatggaagatctgaccatatgtcttaccccgagctctctacttcttcctcatcttgcataatcgcgggataccccaacgaagagggcatgtttgccagccagcatcacagggggcaccaccaccaccaccaccaccaccatcaccaccatcagcagcagcagcaccaggctctgcaaaccaactggcacctcccgcagatgtcttccccaccgagtgcggctcggcacagcctctgcctccagcccgactctggagggcccccagagttggggagcagcccgcccgtcctgtgctccaactcttccagcttgggctccagcaccccgactggggccgcgtgcgcgccgggggactacggccgccaggcactgtcacctgcggaggcggagaagcgaagcggcggcaagaggaaaagcgacagctcagactcccaggaaggaaattacaagtcagaagtcaacagcaaacccaggaaagaaaggacagcatttaccaaagagcaaatcagagaacttgaagcagaatttgcccatcataattatctcaccagactgaggcgatacgagatagcagtgaatctggatctcactgaaagacaggtgaaagtctggttccaaaacaggcggatgaagtggaagagggtaaagggtggacagcaaggagctgcggctcgggaaaaggaactggtgaatgtgaaaaagggaacacttctcccatcagagctgtcgggaattggtgcagccaccctccagcaaacaggggactctatagcaaatgaagacagtcacgacagtgaccacagctcagagcatgcgcacttatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WBP2 N-terminal like
- testis expressed 264
- protease, serine, 22
- LIM and SH3 protein 1

Buy MEOX2-mesenchyme homeobox 2 Gene now

Add to cart