TEX264-testis expressed 264 Gene View larger

TEX264-testis expressed 264 Gene

PTXBC008742

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TEX264-testis expressed 264 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TEX264-testis expressed 264 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008742
Product type: DNA & cDNA
Ncbi symbol: TEX264
Origin species: Human
Product name: TEX264-testis expressed 264 Gene
Size: 2ug
Accessions: BC008742
Gene id: 51368
Gene description: testis expressed 264
Synonyms: ZSIG11; testis-expressed sequence 264 protein; testis expressed gene 264; testis expressed 264
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggacctgctactactgggcctgattgggggcctgactctcttactgctgctgacgctgctggcctttgccgggtactcagggctactggctggggtggaagtgagtgctgggtcaccccccatccgcaacgtcactgtggcctacaagttccacatggggctctatggtgagactgggcggcttttcactgagagctgcagcatctctcccaagctccgctccatcgctgtctactatgacaacccccacatggtgccccctgataagtgccgatgtgccgtgggcagcatcctgagtgaaggtgaggaatcgccctcccctgagctcatcgacctctaccagaaatttggcttcaaggtgttctccttcccggcacccagccatgtggtgacagccaccttcccctacaccaccattctgtccatctggctggctacccgccgtgtccatcctgccttggacacctacatcaaggagcggaagctgtgtgcctatcctcggctggagatctaccaggaagaccagatccatttcatgtgcccactggcacggcagggagacttctatgtgcctgagatgaaggagacagagtggaaatggcgggggcttgtggaggccattgacacccaggtggatggcacaggagctgacacaatgagtgacacgagttctgtaagcttggaagtgagccctggcagccgggagacttcagctgccacactgtcacctggggcgagcagccgtggctgggatgacggtgacacccgcagcgagcacagctacagcgagtcaggtgccagcggctcctcttttgaggagctggacttggagggcgaggggcccttaggggagtcacggctggaccctgggactgagcccctggggactaccaagtggctctgggagcccactgcccctgagaagggcaaggagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protease, serine, 22
- LIM and SH3 protein 1
- PDZ and LIM domain 1
- PDZ and LIM domain 4

Buy TEX264-testis expressed 264 Gene now

Add to cart